slide1
Download
Skip this Video
Download Presentation
INDM 3007

Loading in 2 Seconds...

play fullscreen
1 / 14

INDM 3007 - PowerPoint PPT Presentation


  • 116 Views
  • Uploaded on

INDM 3007. Lecture 4. F-6-P. Xu5P. F-1,6-P. GAP. DHAP. GAP. E-4-P. DHAP. 1,3-PGA. S-1,7-P. 3-PGA. S-7-P. Calvin cycle. 2-PGA. R5P. Xu5P. CO. PEP. 2. Ru-1,5-P. Ru-5-P. Pyruvate. CO. 2. AcetylCoA. oxaloacetate. citrate. TCA. cycle. RuBisCO. 300. PRK. Hydrogenase.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' INDM 3007' - keitha


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

INDM 3007

Lecture 4

slide2

F-6-P

Xu5P

F-1,6-P

GAP

DHAP

GAP

E-4-P

DHAP

1,3-PGA

S-1,7-P

3-PGA

S-7-P

Calvin cycle

2-PGA

R5P

Xu5P

CO

PEP

2

Ru-1,5-P

Ru-5-P

Pyruvate

CO

2

AcetylCoA

oxaloacetate

citrate

TCA

cycle

slide3

RuBisCO

300

PRK

Hydrogenase

200

Enzyme activity (nmol/min/mg protein)

100

0

H2/CO2

Succinate

Succinate/H2

Gluconate/H2

slide4

cbboperon: induced during autotrophic growth

+

cbbR

cbbL

cbbS

cbbX

cbbF

cbbP

cbbT

cbbA

cbbE

+

gap-pgk operon:

super-induced during autotrophic growth

gap

pgk

Genetic organisation of the Calvin cycle

slide5

RegA

regulon

genA

genD

Operon

Regulon: Operons with related metabolic function that share a common regulator

slide6

cbb operon

cbbR

CbbR is a LysR-type regulator

Protein family:

group of proteins sharing sequence similarity

common evolutionary origin

have common function (often not always!) e.g, transcriptional regulator

lysr type regulator

‘lay-out’ of LysR type protein

NH2

COOH

DNA binding domain

Effector binding domain

Multimerisation domain

LysR type regulator
  • Transcriptional activators (and repressors)
  • second most abundant group of regulators, occur in all bacteria
  • Control wide range of functions, ie virulence, antibiotic production etc
  • almost 200 proteins known
  • Molecular mass usually around 36 kDa

Note: every LysR-type regulator binds to different DNA sequence and recognises different ligand

slide8

kDa

175

83

62

48

33

Denaturing conditions: 36 kDa

25

Non denaturing condtions: 79 kDa

CbbR is a dimer in solution

17

7

Expression and purification of CbbR

Strong promoter

cbbR

slide9

Label DNA with radioactive nucleotides

Incubate protein with DNA

Analyse mixture on acrylamide gel

DNA

DNA+protein

Negative

Positive

Analysis of DNA-Protein interaction

Gel retardation or band-shift assay

slide10

cbbL

cbbR

_

+

CbbR

Complex 1

Complex 2

Free fragment

Interaction between CbbR and the cbb promoter

slide11

Label the end of one DNA strand

Incubate with protein

Digest DNA at random with DNaseI

Analysis of DNA-Protein interaction

Footprinting

Trick: Dnase I will digest anywhere, but NOT where protein is bound. This is protected!!

slide12

Denature DNA, and load on gel

DNA

DNA+protein

Protected region: footprint

DNA:DnaseI ratio such that every DNA molecule is only digested once

slide13

cbbL

ATGATGGCGGCCCTCCTGTTTGTTGAGGTGACCTTGCCCCCGCGCCG

cbbR

ATTTC AGGTAAATTTAAATGA TATGA AGTAGGCATTCAGGAAATCTGAAGTG

*

cbbR

Cbb operon

Conclusion: two cbbR dimers bind side by side

cbb operon mRNA

IR3

IR2

IR1

slide14

Effect of spacing between IR1 and IR2/3

on cbb promoter activity

IR1

IR2

IR3

GCCACTTCAGATTTCCTGAATGCCTACTTCATATCATTTAAATTTACCTGAAATCGGCGCGGGGGCA

Spacing (nt)

Activity (%)

5

0

GC

CT

6

0

GC

CT

10

66

GC

CT

CT

12

0

GC

14

0

GC

CT