Promoting fungi in the DNA barcoding movement

1. Promoting fungi in the DNA barcoding movement Keith A. Seifert1 , Ursula Eberhardt2 , Conrad L. Schoch3 1Biodiversity, Agriculture & Agri-Food Canada, Ottawa, Ontario 2 CBS Fungal Diversity Centre, Utrecht, the Netherlands 3 National Centre for Biotechnology Information, Bethesda, MD (GenBank)

2. MSA symposium 2010 Politics! 1:00 Advances in DNA barcoding for fungi. Conrad L. Schoch, Keith A. Seifert Specific Genes 1:30 DNA barcoding using cytochrome c oxidase I (COI): A valuable addition to oomycete molecular taxonomy.Gregg Robideau et al. 2:00 Barcoding the Yeasts – Which Genes? Cletus P. Kurtzman 2:30 Coffee Break Applications 3:00 Barcoding the Dothideomycetes and Sordariomycetes. Andy N. Miller 3:30 Barcoding agaric fungi in the Great Smoky Mountains National Park: What have we learned?   Karen W. Hughes et al. 4:00 Challenges and successes in ITS barcoding of fungal communities in Alaskan boreal forest soil.  L. Taylor 4:30 Discussion Aftermath A chat over beer

3. IMC Symposium U5 – Fungal Barcoding Chairs: Ursula Eberhardt & Keith Seifert Promoting fungi in the DNA barcoding movement KA Seifert*, U Eberhardt, CL Schoch Practice towards DNA barcoding of the nectriaceous fungi P. Zhao, J. Luo, W.-Y. Zhuang* DNA Barcoding of the mycobiota in indoor environments R A Samson* The ITS region as barcoding for medical fungi W Meyer*, C Serena, S Chen, M Arabatzis, A Velegraki DNA barcoding of arbuscular mycorrhizal fungi (Glomeromycota) A. Schuessler*, H. Stockinger, M. Krueger DNA barcoding of fungal endophytes from a Eucalyptus grandis tree in South Africa K Pillay, M Gryzenhout*, B Slippers, MJ Wingfield QBOL - Barcoding organisms of quarantine importance to Europe J.Z. Groenewald*, W. Quaedvlieg, P.J.M. Bonants, N. Boonham, P.W. Crous

4. Overview • The politics of DNA barcoding. • What happened to cox1? • Should ITS be the official Fungal Barcode? • Data standards for the barcode keyword. • Data resources for DNA barcoding. • International barcoding projects Our goal: Motivate mycological participation in DNA barcoding! • Formalize the fungal barcode. • Establish Fungal Working Group • Develop new fungal barcoding projects. • Participate in multi-kingdom projects. “DNA, you know, is Midas’ gold. Everybody who touches it goes mad.” Maurice Wilkins, quoted in The Eighth Day of Creation

5. What is DNA barcoding? Pre-2002 (or whenever) Trichocladium asperum Humicola grisea Pileus comex to comparmulate, lemellae ascending-adnote, peleipellis of clonate cells, chilocystidia ventruiore to eubryludinal, basidiospores with pronviant apical gum pore .……………………………………………………………………………………….Panaeolus mallochii Pileus glalions to finely primrose, lemellae dark blocked umpher, peleipellis hymenform, cheilocystidia a continuous timule margin, bandospins conspeniously compressed ………………………………………………………………………………….. Panaeolus summerbellii Post-2002 (or whenever) CATTTAGAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTATCGAATAAACTGGGTGGGTTGTTGCTGTCCCTCTCGGGGGAACTGTGCACGCCTTACCTTTTTTGTTTTTCCACCTGTGAA ………………………………………………………Panaeolus mallochii CATTATTGAATAAACTTGGTTAGGTTGCTGCTGGCTCCTTGGAGCATGTGCACACCTAGCACCNTTTTTACCACCTGTGCACCCTTTGTAGACCTGGATACCTCTCGAGGAAACTCGGTTTGAGGAC ………………………………………………………………………………. Panaeolus summerbellii …………………………………..……………………………………………………Panaeolus mallochii ….………………………………………………………………………………. Panaeolus summerbellii OR

6. Consortium for the Barcode of Life (CBOL) • Regulates the ‘barcode’ keyword for GenBank • Organization • Secretariat • Smithsonian Institution, Washington, D.C., USA • 5 people • Executive Committee • 7 members, including Pedro Crous • Implementation Board • 19 members, including Conrad Schoch • Members • 200 Member Organizations, 50 countries • Natural history museums, biodiversity organizations • Users: e.g., government agencies • Private sector biotech companies, database providers • Facilitates barcoding but does not fund research www.barcodeoflife.org

7. The Barcode Keyword in GenBankThe Barcode Data Standard • Sequence records with… • Voucher specimens • On-line metadata • Reliable standard of taxonomic identification • Agreed gene region • sanctioned by peer review by CBOL Implementation Board • Sequence traces • Identification of unknowns of ALL kingdoms (except bacteria) • GenBank • Barcode of Life Database (BOLD)

8. Barcode What is DNA Barcoding? Part 2. • All Kingdoms, All Species, One gene (or two or three genes?) • The purpose is identification … NOT phylogeny • In animals, the barcode gene is cytochrome oxidase 1 (cox1 or CO1) • A single copy mitochondrial gene, AT rich • 648 bp region is the core for animals • In plants, the barcode genes are matKand rbcL • Hollingsworth et al., 2009, PNAS 106: 12794–12797, 2009. • In fungi, the barcode gene has not been formalized • By default it is cox1 until an alternative is accepted

9. What is DNA Barcoding? Part 3. • Big science • More than $100,000,000 • Biodiversity Institute of Ontario (Guelph) • Netherlands Centre for Biodiversity Naturalis (Leiden) – € 30 million • High throughput sequencing • Near genome centre volumes • Immediate data release policy (based on public genome model) is controversial • Primer mixes often used for PCR • M13 tagged sequencing primers • Data release papers

10. What is DNA Barcoding? Part 4. • Taxon specific ‘campaigns’ • Development of multikingdom databases • For use by all scientists and the public… not just mycologists • Multi-kingdom projects • QBOL – Quarantine Barcode of Life • Ecological projects • IM-Bol Indoor Mycota Barcode of Life • Geographic Projects • Moorea www.lepbarcoding.org www.barcodingbirds.org www.fishbol.org mooreabiocode.org

11. Barcode of Life Database – BOLDwww.boldsystems.orgMirrored in China, negotiations with ECBol, Australia, Mexico • Accepts ITS sequences as barcodes • Submission open to anyone • Few fungal sequences • Spreadsheets for metadata • No specific fungal format • Process can be tedious • Images of specimens • Descriptions • ‘Automated’ GenBank submission

12. Barcode Submission Tool www.ncbi.nlm.nih.gov/WebSub/index.cgi?tool=barcode • Familiar submission process • Trace archive available • www.ncbi.nlm.nih.gov/Traces/home/ • ITS sequences not yet accepted as barcodes • Submission open to anyone • Few fungal barcode sequences are now cox1 • Metadata must be stored off-site

13. RefSeq Targeted Loci www.ncbi.nlm.nih.gov/RefSeq/ • Bacteria: all type sequences • Fungi: 200 sequences from AFToL, 28S, 18S, just beginning INSD (International Nucleotide Sequence Databases) DDBJ EMBL GenBank model organisms reference organisms genomic level selection & some curation (NCBI) submission RefSeq 16S rRNA* other molecular markers other RNAs

14. RefSeq Accession # Project number Additional references RefSeq references Expanded qualifiers

15. Criticisms of DNA Barcoding • Not science (or bad science) • A threat to classical taxonomy • Removes funding from classical taxonomy • Standardization of markers impossible • Oversimplifies delimiting species • It is not phylogeny • Distrust and questioning of CBOL’s mandate • National pride • Disciplinary pride

16. www.ibolproject.org

17. iBOL Member Nations Each central node should have a high-throughput DNA barcoding facility Now Canada US France Poland Scientific Steering Committee (mycologists): Pedro Crous, Keith Seifert

18. ECBOL- European Consortium for the Barcode of Life Mission: To unleash the potential of European expertise and collections to contribute towards identifying life on earth. • Plan: • Establish a Network of European Leading Laboratories (NELL) • Formalise National DNA barcoding campaigns in each European country • Establish new projects and barcoding campaigns, • Functioning as the European node for international initiatives such as iBOL Participating countries: Belgium, Finland, France, Germany, Italy, Lithuania, Netherlands, Norway, Poland, Portugal, Spain, Switzerland, U.K. www.ecbol.org ECBOL2 meeting June 2010, Braga, Portugal Lorenzo Lombard l.lombard@cbs.knaw.nl

19. Selecting barcode genes • International Nucleotide Sequence Database Collaboration • INSDC, GenBank, the European Molecular Biology Laboratory and the DNA Data Bank of Japan • CBOL Implementation Board decides by peer review which gene regions receive BARCODE status • Possible reasons for rejection of cox1 • PCR problems (amplification or primer problems) • Patterns of inter- and infraspecific variation • Resolving power • Selection of new genes • Patterns of inter- and infraspecific variation • Prefer a ‘barcode’ gap • Universality of primer pair etc.

20. Comparison of barcodes in Oomycetes (250 species) ITS cox1 LSU n=1179 n= 1179 n=375 Min 0 Mean 0.297 Max 0.539 Min 0 Mean 0.102 Max 0.307 Min 0 Mean 0.098 Max 0.201 Percent of strains within species between species Min 0 Mean 0.004 Max 0.062 Min 0 Mean 0.004 Max 0.037 Min 0 Mean 0.002 Max 0.037 Average pairwise distance Courtesy Gregg Robideau & André Lévesque

21. cox1 Barcoding of Eumycota & Oomycota 0 introns F. oxysporum genome 1 1 intron F. circinatum DAOM235753 F. sacchari DAOM 235795 2 introns 3 spp./3 major clades. Identical barcodes. F. verticillioides genome ** 3 introns F. circinatum DAOM 235752 b1 7 introns F. circinatum DAOM 235752 b5 F. graminearum DAOM 235624 F. graminearum DAOM 235800 F. oxysporum genome 2 Species resolution in Penicillium cox1 67.1 % B-tub 81.2 % ITS 24.5 % Fusarium. Low resolution. Multiple copies.

22. All Fungi Barcode of Life Planning Workshop Smithsonian Conservation and Research Center Front Royal, Virginia 13-15 May 2007 Zasmidium nocoxi Crous Rossman, AY. 2007. Report of the Planning Workshop for All Fungi DNA Barcoding. Inoculum 58(6): 1-5.

23. The ITS reality… Hurray! • Large reference database • most not barcode data standard compliant • Robust primers • Strong demand from many mycologists that this be the fungal barcode • Especially ecologists studying environmental metagenomics

24. The ITS Reality – BOO! • Multiple copies within species • At this conference… • Dan Lindner – Laetiporus, this conference • Uwe Simon & M. Weiss – Ascomycetes • Of concern for cloning based and metagenomic studies wanting to use barcode ID databases • Serious lack of resolution in Ascomycetes • Possibly too short • 500-700 bp optimum barcode but subtract 150 bp 5.8S… • Chimera problems for some methodological approaches

25. The Ascomycete Barcode Problem Dikarya • ITS (and cox1) lack resolution in many groups • A second barcode is needed • TEF1-α • RPB1 or RPB2 • Mcm7 Schmitt et al. 2009. Persoonia 23: 35-40. • FG1565 • MS204 • FG1093 • V. Robert @ CBS/ C. Lewis @ AAFC • Ascomycete Barcode Working Subgroup? Fungi RPB1 RPB2 TEF • dowalker@eden.rutgers.edu RPB1 per net RPB2 Courtesy J. Spatafora TEF

26. Action • Establish Fungal DNA Barcoding Working Group • Chair: Conrad Schoch • International Membership • 10-15 members • Establish Ascomycete subgroup (or other subgroups?) • Establish Working Plan • Prepare Fungal Barcoding proposal • For peer reviewed publication • For CBOL implementation board approval • CBOL will support meetings of WG as necessary

27. Possible approaches • Volunteers needed for Fungal Working Group • Collaborators to provide data • Mine data from existing publications • Collaborators to provide DNA • Multiple strains per species • Multiple species per genus • Authorship open to all who contribute • AFTOL model • Sequencing of other markers • part of main proposal • or as separate activity • CBOL agreement with Life Tech • CONTACT: • Conrad Schoch: schoch2@ncbi.nlm.nih.gov

28. Fungal DNA Barcoding – Proposed Proposal • General Barcode for Fungi • rDNA internal transcribed spacer (ITS) • Secondary barcodes • Yeasts • rDNA large subunit (28S, LSU) D2 region • Ascomycetes • Second barcode required, subsequent proposal • Oomycetes • A separate proposal • Data on ITS, cox1 and LSU now being prepared for publication • 2 barcode system • rDNA internal transcribed space (ITS) • rDNA large subunit (28S, LSU) D2 region • Other groups?

29. CBOL Implementation BoardPeer review of barcode marker proposals Chairs • Robert Hanner, University of Guelph, Databases • Peter Hollingsworth, Royal Botanic Gardens Edinburgh, Plant WG • Line Le Gall, Muséum National d’Histoire Naturelle, Paris; Protist WG • Neil Sarkar, Marine Biol. Lab., Woods Hole, MA; Data analysis WG • Conrad Schoch, NCBI, GenBank Taxonomy, Fungal WG • Lee Weigt, Smithsonian Inst., Washington, DC; Leading Lab Network CBOL Campaign and Project Leaders • George Amato, American Museum of Natural History, Conservation • Damon Little, NY Botanical Garden, TreeBOL • Marc De Meyer, Royal Mus. Central Africa, Belgium; Tephritid Barcoding Initiative • Yvonne Linton, NHM, London; Mosquito Barcoding Initiative • Dirk Steinke, University of Guelph, MarBOL • Mark Stoeckle, Rockefeller University, ABBI • Pablo Luis Tubaro, Museum of Natural Sciences, Argentina, ABBI Liaisons for Associated Initiatives • Paul De Barro, CSIRO Agriculture Australia, invasive species • Scott Federhen, NCBI, GenBank Taxonomy • Paul Hebert, University of Guelph, iBOL • Daniel Masiga, ICIPE, Nairobi, Kenya, East Africa • Chris Meyer, Smithsonian Institution, Washington, Moorea/BioCode • Sujeevan Ratnasingham, Biodiversity Institute of Ontario, BOLD

31. Websites www.barcodeoflife.org www.ecbol.org Thanks for images: Pedro Crous André Lévesque & Gregg Robideau Joey Spatafora www.lepbarcoding.org • Keith Seifert: keith.seifert@agr.gc.ca • Ursula Eberhardt: ursula.eberhardt@cbs.knaw.nl • Conrad Schoch: schoch2@ncbi.nlm.nih.gov www.qbol.org www.barcodingbirds.org www.fishbol.org www.ibolproject.org www.boldsystems.org