Improved RNA
This presentation is the property of its rightful owner.
Sponsored Links
1 / 22

Improved RNA Secondary Structure Prediction by Maximizing Expected Pair Accuracy PowerPoint PPT Presentation


  • 67 Views
  • Uploaded on
  • Presentation posted in: General

Improved RNA Secondary Structure Prediction by Maximizing Expected Pair Accuracy. Zhi John Lu, Jason Gloor, and David H. Mathews University of Rochester Medical Center, Rochester, New York. RNA Secondary and Tertiary Structure:. AAUUGCGGGAAAGGGGUCAA CAGCCGUUCAGUACCAAGUC

Download Presentation

Improved RNA Secondary Structure Prediction by Maximizing Expected Pair Accuracy

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -

Presentation Transcript


Improved rna secondary structure prediction by maximizing expected pair accuracy

Improved RNA

Secondary Structure Prediction by Maximizing

Expected Pair Accuracy

Zhi John Lu, Jason Gloor, and David H. MathewsUniversity of Rochester Medical Center, Rochester, New York


Improved rna secondary structure prediction by maximizing expected pair accuracy

RNA Secondary and Tertiary Structure:

AAUUGCGGGAAAGGGGUCAA

CAGCCGUUCAGUACCAAGUC

UCAGGGGAAACUUUGAGAUG

GCCUUGCAAAGGGUAUGGUA

AUAAGCUGACGGACAUGGUC

CUAACCACGCAGCCAAGUCC

UAAGUCAACAGAUCUUCUGU

UGAUAUGGAUGCAGUUCA

Cate, et al. (Cech & Doudna).

(1996) Science 273:1678.

Waring & Davies. (1984) Gene 28: 277.


Improved rna secondary structure prediction by maximizing expected pair accuracy

Gibbs Free Energy Change:

Ki =

=

= Ki/Kj =

The structure with the lowest DG° is the

most favored at a given temperature.


Improved rna secondary structure prediction by maximizing expected pair accuracy

Nearest Neighbor Model for Free Energy Change of a Sample Hairpin Loop:

Mathews et al., J. Mol. Biol., 1999, 288: 911.

Mathews et al., PNAS, 2004, 101: 7287.


Rna secondary structure prediction accuracy

RNA Secondary Structure Prediction Accuracy:

Percentage of Known Base Pairs Correctly Predicted:

Mathews, Disney, Childs, Schroeder, Zuker, & Turner. 2004. PNAS 101: 7287.


Limitations to prediction of the minimum free energy structure

Limitations to Prediction of the Minimum Free Energy Structure:

  • A minimum free energy structure provides the single best guess for the secondary structure.

  • Assumes that:

    • RNA is at equilibrium

    • RNA has a single conformation

    • RNA thermodynamic parameters are without error

      • Non-nearest neighbor effects

      • Some sequence-specific stabilities are averaged


A method that looks at the probability of a structure could be more informative

A Method that Looks at the Probability of a Structure could be more Informative:

  • A partition function can be used to determine the probability of a structure at equilibrium.


The partition function q

The Partition Function, Q:


So what is q good for

So, what is Q good for?

where k is the sum over all structures with the i-j base pair.


Accuracy

Accuracy:

  • Sensitivity – what percentage of known pairs occur in the predicted structure.

  • Positive Predictive Value (PPV) – what percentage of predicted pairs occur in the known structure.

  • PPV ≤ Sensitivity because the structures determined by comparative sequence analysis do not have all pairs and there is a tendency to over-predict base pairs by free energy minimization.


Applying p i j to structure prediction

Applying Pi,j to Structure Prediction:

PPV

PBP≥ 90%

PPV

PBP≥ 70%

PPV

PBP> 50%

Positive

Predictive

Value (PPV)

PPV

PBP≥ 99%

PPV

PBP≥ 95%

Sensitivity

Mathews. RNA. 10: 1178. (2004).


Percent of predicted bp above threshold

Percent of Predicted BP above Threshold:

PPV

PBP≥ 99%

PPV

PBP≥ 95%

PPV

PBP≥ 90%

PPV

PBP≥ 70%

PPV

PBP> 50%

Mathews. RNA. 10: 1178. (2004).


Color annotation

Color Annotation:

E. coli 5S rRNA


Structures constructed from highly probable pairs

Structures Constructed from Highly Probable Pairs:

PBP≥ 99%

PBP≥ 90%

PBP≥ 70%

PBP> 50%


Maximizing expected accuracy

“Maximizing Expected Accuracy:”


Contrafold

CONTRAfold:

  • “Statistical learning method” to predict Pi,j

  • Generate structures:

Where:

Bioinformatics. 22: e90-e98. (2006).


Implement maximum expectation

Implement Maximum Expectation:

  • Zhi John Lu, Jason Gloor, David Mathews

  • Implement dynamic programming algorithm

    using partition function prediction of Pi,j.

  • Also implement suboptimal structure prediction.

    • Alternative hypotheses.


Sensitivity and ppv vs g

Sensitivity and PPV vs. g:


Comparison

Comparison:


Summary

Summary:

  • Maximizing expected accuracy can predict structures with greater sensitivity and positive predictive value than free energy minimization.

  • Maximizing expected accuracy using an underlying thermodynamic model is more accurate than an underlying statistical model.


Improved rna secondary structure prediction by maximizing expected pair accuracy

Methanococcus thermolithotrophicus 5S rRNA (Szymanski et al., 1998):

MaxExpect Predicted Structure:


Improved rna secondary structure prediction by maximizing expected pair accuracy

Minimum Free Energy Structure:

CONTRAfold

Predicted Structure:


  • Login