The 454 and Ion PGM at the Genomics Core Facility
Download
1 / 45

The 454 and Ion PGM at the Genomics Core Facility - PowerPoint PPT Presentation


  • 96 Views
  • Uploaded on

The 454 and Ion PGM at the Genomics Core Facility. Dr. Deborah Grove, Director for Genetic Analysis Genomics Core Facility Huck Institutes of the Life Sciences Penn State University. Services DNA Sequencing Illumina, 454 and Ion PGM Next Gen Sequencing Microarray

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about ' The 454 and Ion PGM at the Genomics Core Facility' - faunia


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

The 454 and Ion PGM at the Genomics Core Facility

Dr. Deborah Grove, Director for Genetic Analysis

Genomics Core Facility

Huck Institutes of the Life Sciences

Penn State University


  • Services

  • DNA Sequencing

  • Illumina, 454 and Ion PGM Next Gen Sequencing

  • Microarray

  • Genotyping – VNTRs, SNPs, Open Array

  • qPCR by Real-Time

  • DNA Synthesis

  • DNA Extraction and Storage of DNA from Buccal Swabs








Next-Generation Sequencers:

Massively Parallel Platforms

  • Roche 454FLX+ v2.8 – 500 million bases per run, 800 to 1000 bases

  • Ion PGM 318 chip – 2 to 4 billion bases per run, 400 base length

  • (Ion Proton)


Roche 454 – Next Generation Sequencer

  • Pyrosequencing

  • FLX+ v2.8 has 800 to 1000 bp read

  • 160 million bases per

  • full slide

454 FLX +


454 Titanium Sequencing Applications

  • Whole Genome – Shotgun 500 ngs dsDNA

  • Whole Genome -- Paired-End (3kb, 8kb, 20kb) 15 to 30 ugs dsDNA

  • Amplicon/Metagenomics 5 ngs

  • Transcriptome RNA


DNA Fragmentation by nebulization

Fragment End Repair

AMPure Bead Clean up

Adaptor-Ligation

Small Fragment Removal

Library Quality Assessment and Quantification


Primer Sets for Metagenomics

  • 16s Bacteria

  • ITS for Fungus

  • 18s set for Fungus and other Eukaryotes, targeting Protists

  • Archaea targeting both Crenarchaeota and Euryarchaeota


Amplicon Preparation

27F_M6CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCMTGGCTCAG

907R_M6TATGCGCCTTGCCAGCCCGCTCAGCCCCGTCAATTCMTTTGAGTTT


16S Variable Regions

27F_M6CGTATCGCCTCCCTCGCGCCATCAGATATCGCGAGAGAGTTTGATCMTGGCTCAG

907R_M6TATGCGCCTTGCCAGCCCGCTCAGCCCCGTCAATTCMTTTGAGTTT


Amplicons
Amplicons

27F

518R

907R


  • One Bead

  • One DNA library

  • NTPs, Taq etc.



314 chip
314 CHIP

316 CHIP


Approximate Cost from Genome Library thru Sequencing

314 Chip 160 million bases, 400,000 reads

318 Chip 3 billion bases, 6 to 8 million reads

$1500 to $2000


Coverage
Coverage

Full Plate = 1 million reads, 300 million bases

½ plate = 500,000 reads, 150 million bases

1 Quad = 200,000 reads, 60 million bases



Full Plate = 1 million reads, 300 million bases

½ plate = 500,000 reads, 150 million bases

1 Quad = 200,000 reads, 60 million bases

http://www.youtube.com/embed/yVf2295JqUg


Coverage2
Coverage

Full Plate = 1 million reads, 300 million bases

½ plate = 500,000 reads, 150 million bases

1 Quad = 200,000 reads, 60 million bases


Full Plate = 1 million reads, 300 million bases

½ plate = 500,000 reads, 150 million bases

1 Quad = 200,000 reads, 60 million bases


Full Plate = 1 million reads, 300 million bases

½ plate = 500,000 reads, 150 million bases

1 Quad = 200,000 reads, 60 million bases


  • Applications

  • Bacterial and Viral Genomes

  • Amplicons

  • Ampliseq Panels for SNP variants


  • Ampliseq Cancer Panel

  • Only 10 ngs or less

  • FFPE tissues

  • Single Cells

  • Libraries take 3.5 hours

  • 2800 hot spots


  • Use Ion AmpliSeq Designer


  • 314 Chip 160 million bases, 400,000 reads

  • 318 Chip 3 billion bases, 6 to 8 million reads


  • Pac Bio

    • No amplification required

    • Single molecule

    • Several thousand base reads

    • (4 to 20 kb)

    • Least GC-biased sequencing

    • Run time 30 minutes


    Applications

    • Genomes: Finish Genomes and improve assembly with extra long reads (4000bp average and up to 20,000)

    • Genomic Complexity: Allow haplotype expansion, full length transcripts and splice variants, repeat expansions, minor variants

    • Epigenome: Detects base modifications using kinetics


    Thanks to:

    The Huck Institutes of the Life Sciences

    Lloyd and Dorothy Huck

    And the others in the lab…


    ad