DNA Transcription and Translation

1. DNA Transcription and Translation Sections 12.3 and 12.4

2. Do Now • 1. How many chromosomes do we have? • 2. What is a chromosome made of? • 3. What is a gene?

3. Objectives • SWBAT label parts of a RNA molecule • SWBAT compare and contrast DNA and RNA • SWBAT define gene, polypeptide, and amino acid.

4. Gene • Segment of DNA that codes for a protein • DNA codes for RNA and RNA makes protein

5. One Gene – One Enzyme • The Beadle and Tatum experiment showed that one gene codes for one enzyme. • One gene codes for one polypeptide. • polypeptide - a chain of covalently bonded amino acids. • (proteins are made of one or more polypeptide)

7. 12.3 DNA, RNA, and Protein

8. Let’s make some observations about RNA’s structure

9. RNA • RNA stands for: • Ribonucleic acid • RNA is found: • Nucleus and Cytoplasm

10. RNA Structure • Like DNA, RNA is made up of subunits called _____________, which are made of three parts: • Sugar (ribose) • Phosphate • Nitrogen Base

11. RNA’s Nitrogen Bases • Adenine (A) • Cytosine (C) • Guanine (G) • Uracil (U)

12. There are 3 types of RNA: • Messenger RNA (mRNA) • Ribosomal RNA (rRNA) • Transfer RNA (tRNA)

13. All RNA is … • Single stranded • Many different shapes • “Cheap copy” of DNA

16. Do Now • 1. What is a protein made of? • 2. Explain the process between DNA and proteins.

17. Objectives • SWBAT draw and create a segment of RNA • SWBAT answer questions on your segment.

18. Do Now • Compare and Contrast DNA and RNA.

19. Objectives • SWBAT define RNA polymerase, transcription, promotor, termination sequence. • SWBAT identify the steps involved in transcription • SWBAT answer question on transcription.

20. Transcription • First step in making proteins • Process of taking one gene (DNA) and converting into a mRNA strand • DNA -> RNA • Location: • Nucleus of the cell

22. Steps to Transcription • 1. An enzyme attaches to the promoter (start signal region) of a gene and unwinds the DNA

23. Steps to Transcription (Cont.) • 2. One strand acts as a template.

24. Steps to Transcription (Cont.) • 3. A mRNA copy is made from the DNA template strand by RNA polymerase • 4. A mRNA copy is made until it reaches the termination (stop signal) sequence • 5. The two strands of DNA rejoin.

25. Template vs. Non Template Strand

28. Transcription animations • http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a2.html • http://www.fed.cuhk.edu.hk/~johnson/teaching/genetics/animations/transcription.htm

29. Transcribe this DNA to mRNA

30. Think- Pair- Share • 1. Where in the cell does transcription occur? • 2. What nucleic acids are involved in the process of transcription? • 3. What is the importance of transcription? • 4. In transcription, how come the whole DNA molecule is not copied into mRNA? • 5. How does one gene differ structurally from another? • 6. Because one gene differs from another, what molecules in the cell will also be different?

32. Do Now • Label the Transcription diagram

33. Objectives • SWBAT label a diagram of transcription • SWBAT answer questions on transcription.

34. Do Now • List the steps to transcription.

35. Do Now • 1. What is transcription? • 2. Transcribe this DNA sequence: • TCAGTTGAGGAACCT

36. Objectives • 1. SWBAT discuss translation using pictures, words, models, and online animations. • 2. SWBAT draw out translation in their notes. • 3. SWBAT complete a conclusion activity using a worksheet. • 4. SWBAT answer multiple choice and short answer questions about transcription and replication.

37. mRNA Processing • Pre-mRNA – the original sequence of RNA created during transcription • mRNA reaches the ribosomes

38. RNA Processing

39. After transcription the pre-mRNA molecule undergoes processing • 5’ cap is added • Poly A tail is added to the 3’ end • Introns are removed.

40. RNA Processing • In Eukaryotes only • Introns- non-coded sections • Exons- codes for a protein • Before RNA leaves the nucleus, introns are removed and exons are spliced together • A cap and poly A tail are added to ends of the sequence • mRNA leaves the nucleus through the nuclear pores

41. Why is it necessary to add the poly A tail and 5’ cap?

42. Let’s try an activity (11.5) • http://highered.mcgraw-hill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120077/bio30.swf::How%20Spliceosomes%20Process%20RNA

44. Pg. 339 • Pg. 339

45. 3’ CAUGAUGUACGAUACGUA 5’ cap Let’s an example… • Original DNA Sequence (DNA): • 5’ GTACTACATGCTATGCAT 3’ • Translate it (RNA): • 3’ CAUGAUGUACGAUACGUA 5’ • Add the 5’ cap:

46. 3’ CAUGAUGUACGAUACGUA 5’ cap 3’ CAUGACGGUA 5’ cap 3’AAAAACAUGACGGUA 5’ cap Finish the job! • Remove the introns “UGUA” and “AUAC”: Add a poly A tail onto the 3’ end

47. Get a new partner! • DNA Strand of non-template strand: • 5’ ATCGGTAGAGTATTTACAGATA 3’ • Remove introns: • CGGUA UUACAG

48. Think, Pair, Share • Take a minute think on your own, then pair with your partner, and share your ideas! • Evolutionary, why do you think there are introns? • Where did they come from? • Why do we have them? • Remember there is NO wrong answer!

49. PROTEINS!

50. Proteins are made up of amino acids!!! • Proteins are polymers of amino acids • Only 20 different amino acids • BUT there are hundreds of thousands of different proteins How can this be?