1 / 17

From Gene to Protein : An exercise in breaking the code

From Gene to Protein : An exercise in breaking the code. New copy (RNA) is read and translated. Genes (DNA). Make copies of itself. www.squidoo.com/geneticsresearch. Amino acids (protein) are formed. A trait is expressed. VC: What is phenotype. Cracking the Code. DNA.

dawson
Download Presentation

From Gene to Protein : An exercise in breaking the code

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. From Geneto Protein: An exercise in breaking the code

  2. New copy (RNA) is read and translated Genes (DNA) Make copies of itself www.squidoo.com/geneticsresearch Amino acids (protein) are formed A trait is expressed VC: What is phenotype

  3. Cracking the Code DNA VC: Cracking the code copied and read RNA translated http://entomology.wisc.edu/~goodman/wgr...rch.html PROTEIN

  4. DNA COPIES ITSELF:Base pairings: A- T C – GDNA moleculeunzips breaking the base pairs forming 2 sides VC: DNA Replication VC: How DNA copies itself

  5. A: TACCGGATGCCAGATCAAATCWhat is the other side?__________________________ Given the code of a DNA molecule, what would be the code of the new DNA strand? B: TACGGGGGCGTAACCACAACTWhat is the other side?__________________________

  6. A: TACCGGATGCCAGATCAAATCWhat is the other side? Given the code of a DNA molecule, what would be the code of the new DNA strand? ATGGCCTACGGTCTAGTTTAG B: TACGGGGGCGTAACCACAACTWhat is the other side?ATGCCCCCGCATTGGTGTTGA

  7. 2.CODE IS READ into RNA. The code of the new strand (DNA copy) is READwith theT replaced with a new base Uracil or U to make RNA. From #1: (DNA copy) ATGGCCTACGGTCTAGTTTAG A: ____________________________________ B: ____________________________________

  8. 2.CODE IS READ. The code of the new strand (DNA copy) is READwith theT replaced with a new base Uracil or U. ATGGCCTACGGTCTAGTTTAG A: ____________________________________ ATGCCCCCGCATTGGTGTTGA B: ____________________________________ AUGGCCUACGGUCUAGUUUAG AUGCCCCCGCAUUGGUGUUGA

  9. VC: From DNA to protein

  10. 3. CODE IS TRANSLATED. The code is read in groups of 3 called codons). AUGGCCUACGGUCUAGUUUAG A: ____________________________________ B: ____________________________________

  11. 3. CODE IS TRANSLATED. The code is read in groups of 3 called codons). AUGGCCUACGGUCUAGUUUAG A: ____________________________________ B: ____________________________________ AUG GCC UAC GGU CUA GUU UAG AUGCCCCCGCAUUGGUGUUGA AUG CCC CCG CAU UGG UGU UGA

  12. Find the Amino Acid sequence that is coded: Use the following guide. AUG GCC UAC GGU CUA GUU UAG A: ____________________________________

  13. AMINO ACID SEQUENCE AUG GCC UAC GGU A: Methionine-Alanine-Tyrosine-Glycine- CUA GUU UAG Leucine-Valine-Stop

  14. AMINO ACID SEQUENCE AUG GCC UAC GGU CUA GUU UAG A: Methionine-Alanine-Tyrosine-Glycine- Leucine-Valine-Stop B: Methionine-Proline-Proline-Histidine- Tryptophan-Cysteine-Stop AUG CCC CCG CAU UGG UGU UGA

  15. Cracking the Code DNA VC: Cracking the code copied and read RNA translated http://entomology.wisc.edu/~goodman/wgr...rch.html PROTEIN

  16. New copy (RNA) is read and translated Genes(DNA) Make copies of itself Crossover (mixing of code) www.squidoo.com/geneticsresearch Amino acids (protein) are formed A trait is expressed VC: What is phenotype

More Related