1 / 10

RNA Structure

RNA Structure. Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA. DNA Decoding. RNA is made up of four components 1. Phosphate 2. Sugar (Ribose, not Deoxyribose) 3. Nitrogen Bases (A, U, C, G- instead of having Thymine RNA contains Uracil

conner
Download Presentation

RNA Structure

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. RNA Structure Date: 1/9/06 Day A Objectives Identify the role of RNA Compare RNA with DNA

  2. DNA Decoding • RNA is made up of four components • 1. Phosphate • 2. Sugar (Ribose, not Deoxyribose) • 3. Nitrogen Bases (A, U, C, G- instead of having Thymine RNA contains Uracil • 4. Hydrogen bonds between the two nucleotides

  3. RNA Structure • RNA is called Ribonucleic Acid • RNA is the principle molecule that carries out the instructions coded in DNA • RNA is considered a macromolecule • RNA has three different types: • 1. mRNA (messenger RNA- mailman) • 2. rRNA (ribosomal RNA- the factory) • 3. tRNA (transfer RNA- deliveryman)

  4. DNA Deoxyribonucleic Acid Deoxyribose Sugar Uses thymine (A=T, C=G) Only found in nucleus One type Master copy RNA Ribonucleic Acid Ribose Sugar Uses Uracil (A=U, C=G) Can move from nucleus to cytoplasm Three types (mRNA, rRNA, tRNA) Blueprint Comparing DNA with RNA

  5. Forms Of RNA

  6. Transcription • Transcription: Is the process by which RNA is made • In transcription part of the nucleotide sequence of DNA molecule is copied into RNA • DNA acts as template for RNA, • A template is a pattern, or guide, from which a copy can be made • MAJOR COMPONENT • RNA Polymerase

  7. RNA Polymerase • Is an enzyme the binds directly to a molecule of DNA • RNA Polymerase produces a strand of RNA • One nucleotide at a time • RNA turns all T U • Example: AACT  • UUGA • It gives it its complementary pair without the T’s

  8. RNA Polymerase • Example #2 • DNA strand , give the complementary strand • AATCGGCATTACGAACTACCGA • TTAGCCGTAATGCTTGATGGCT • From the Original Strand give the RNA • UUAGCCGUAAUGCUUGAUGGCU • So RNA is the some pattern as the complementary strand with T replacing U

  9. RNA as a Message • First, single sequence in DNA may be copied again and again • Second, by making RNA, the cell is able to keep its DNA in reserve controlling access to it and carefully regulating its use an dreplication

  10. QUIZ • Original Strand:CGCCTGACTAGGACATACGGG • Complementary Strand:? • RNA strand: ? • Answer • Complementary Strand: GCGGACTGATCCTGTATGCCC • RNA Strand: GCGGACUGAUCCUGUAUGCCC

More Related