Cloning Overview

1. Cloning Overview 4/29/19 Monday Night Meeting Ben Maldonato

2. Helpful Tools Oligonucleotide (Primer) Analysis Tools: • https://www.eurofinsgenomics.eu/en/ecom/tools/oligo-analysis/ • https://www.genscript.com/tools/pcr-primers-designer New England Biolabs (NEB) Tool Suite: • https://www.neb.com/tools-and-resources/interactive-tools

3. Other Protocol Walkthroughs • https://www.addgene.org/protocols/pcr-cloning/ • https://www.addgene.org/protocols/

4. Outline • Background and Intro • Plasmids and Why We Care • Base Pairing and Reverse Complement • Restriction Enzymes • Sticky vs Blunt Ends • Polymerase Chain Reaction (PCR) • Primer Design and Considerations • Restriction Digestion • Ligation and Transformation • Sequencing • Walkthrough with Data!

5. Plasmids • Circular pieces of DNA that can be inserted into a host of organisms • Primarily used with E. coli for recombinant protein production • Glossary: • Origin of Replication – Site of plasmid replication • Antibiotic Resistance Gene – Confers resistance to a particular antibiotic. Useful for selecting plasmid-containing bacteria. • Promoter – Enables transcription of the insert. • Gene of Interest – Particular gene sequence inserted into the plasmid for expression. Image courtesy of Addgene.org

6. DNA Structure and Reverse Complement • Adenine (A) and thymine (T) form a pair with 2 hydrogen bonds • Guanine (G) and cytosine (C) form a pair with 3 hydrogen bonds • Using the top sequence “ATGCGCT…” as our template strand: • The reverse sequence is the top strand read from 3’ to 5’ • The complement sequence is the bottom strand read from 3’ to 5’ • The reverse complement is the bottom strand read from 5’ to 3’ • This is what we would synthesize if we were designing a reverse primer as it binds correctly to the template strand. Image courtesy of Wikipedia.org

7. Restriction Enzymes • Restriction enzymes cut DNA in very specific ways. • Sticky ends: Have an extra overhanging section. • Blunt ends: No overhanging section. • Endogenous role is to destroy invading viral DNA in prokaryotes. • Ideal to use two different restriction enzymes that produce sticky ends. • Blunt ends and ligation into a single sticky-ended restriction site may cause orientation problems. EcoRI digest is very common Image courtesy of Thermo Fisher

8. PCR Basics Annealing Tm: Temperature to bind primers to single stranded DNA Melting Tm: Temperature to separate double stranded DNA The process is exponential so large amounts of DNA can be synthesized from very little template DNA. Image adapted from Thermo Fisher

9. Primer Design Potential Problems • General Guidelines: • Usually 18-30 bp. (too long or too short causes problems) • Avoid repeats and palindromes • Causes problematic secondary structure • GC content between 40-60% • Want to avoid very high and very low annealing temperatures • Can avoid some problems using online design tools • Generally need to do trial and error • Addition of primer overhangs allows addition of extra nucleotide sequences to existing gene of interest! Rouchka et al. MPrime: efficient large scale multiple primer and oligonucleotide design for customized gene microarrays. 2005. BMC Bioinformatics.6: 175

10. Primer Design Example • Let’s say you have a gene sequence: • 5’ ATATATAAAGGGCCC…………TTCGCGCGATCACCGATG 3’ • Forward primer: • Can use the 5’ end of the gene of interest. Will bind to the complementary strand and allow elongation. • Reverse primer: • Need to synthesize reverse complement of 3’ end of gene of interest. • 5’ CATCGGTGATCGCGCGAA 3’ (Synthesizing the complement won’t orient correctly)

11. PCR Annealing Temperature Optimization • Too low annealing temperature: • Off target binding • Evidenced by lower MW bands • Too high annealing temperature: • Not shown here • What would happen? • No PCR products observed usually • Too warm for the primers to efficiently bind to the single stranded DNA before the next PCR cycle starts. Image courtesy of Thermo Fisher

12. PCR Annealing Temperature Optimization • Too low annealing temperature: • Off target binding • Evidenced by lower MW bands • Too high annealing temperature: • Not shown here • No PCR products observed • Too warm for the primers to efficiently bind to the single stranded DNA before the next PCR cycle starts. Image courtesy of Thermo Fisher

13. Advanced Primer Design – Primer Overhangs • Overhang PCR allows addition of extra DNA • Useful for adding restriction sites! • Makes optimization of PCR conditions difficult • Much higher chance of primer problems • Primer dimers • Hairpin loops • Self-annealing • Off-target binding due to strange Tm Newly added DNA sequence Image courtesy of Bitesize Bio

14. Restriction Digestion – Obtaining a plasmid backbone • Online tools allow you to determine restriction sites for plasmid DNA sequences. • Choose restriction enzymes that work with plasmid of choice. • Can add any restriction site you want to gene of interest using overhang PCR! • Cut plasmid and run on DNA gel Should see two major bands. • Linearized backbone and insert • Have to gel purify linearized backbone band using a kit. (Lots of choices, I suggest Qiagen) Image courtesy of Addgene.org

15. Ligation – Formation of a New Plasmid • Combine digested insert and linearized backbone in presence of DNA ligase and ATP. • Shoot for a molar ratio of 1:3 backbone:insert • May need to alter if ligation isn’t working well • Very important that backbone has been purified! • Only want your insert present, not the original one too. • As always, use a kit. Qiagen is good Image courtesy of Addgene.org

16. Transformation – First Chance at Plasmid Verification • Heat shock transformation protocol with E. coli host strain (DH5α, Stellar, etc) • Plate multiple different amounts of transformed stock • Helps give appropriate colony density without having to guess transformation efficiency • Make sure LB agar plates contain correct antibiotic/selection marker! • Check plates for transformant colonies 12-24 hours later • Can include a non-transformed negative control and a known plasmid positive control Image courtesy of Thermo Fisher

17. Sequencing – Plasmid Verification Gold Standard • Fluorescently tagged dideoxynucleotides can’t be used to elongate DNA chains. • Result in terminated DNA synthesis • Separate different sized DNA chains with gel electrophoresis and analyze via fluorometer • “Read” DNA sequence from shortest to longest fragment • Exceedingly cheap nowadays due to automation (~$8 per sample) • Primers should be 30-50 bp upstream of region of interest. • Really small DNA fragments are hard to resolve so you can’t read them well. Image courtesy of Online Biology Notes

18. Real Data! • Want to insert my METTL7B gene sequence into this pGEX-3X plasmid. • What selection marker is present? • Is there an affinity tag? If so, N- or C- terminal? • What restriction enzyme sites are present? • What sequencing primers can be used? Image courtesy of Addgene.org

19. Real Data! • Want to insert my METTL7B gene sequence into this pGEX-3X plasmid. • What selection marker is present? • Is there an affinity tag? If so, N- or C- terminal? • What restriction enzyme sites are present? • What sequencing primers can be used? Image courtesy of Addgene.org

20. Real Data! • Want to insert my METTL7B gene sequence into this pGEX-3X plasmid. • What selection marker is present? • Is there an affinity tag? If so, N- or C- terminal? • What restriction enzyme sites are present? • What sequencing primers can be used? Image courtesy of Addgene.org

21. METTL7B Plasmid Gene Sequence ATGGATATTTTAGTGCCATTGTTACAGCTTCTTGTGTTGCTGCTGACTCTTCCTCTTCACTTGATGGCGTTGTTAGGTTGTTGGCAACCTTTGTGTAAAAGCTACTTCCCCTACTTAATGGCTGTGTTAACCCCAAAATCGAACCGGAAGATGGAATCCAAAAAGAGAGAGTTATTTTCTCAGATTAAGGGGCTTACAGGTGCGTCTGGTAAGGTAGCACTGTTGGAGTTAGGATGTGGGACCGGAGCTAACTTCCAATTTTATCCTCCGGGCTGCCGGGTTACGTGCCTTGACCCTAATCCGCATTTTGAAAAATTCTTGACTAAATCTATGGCAGAAAATCGTCACTTACAGTACGAGAGATTCGTTGTGGCTCCGGGTGAAGATATGAGACAACTGGCGGACGGATCAATGGATGTTGTTGTATGCACCCTTGTGTTATGCTCCGTTCAGTCCCCACGGAAGGTTCTGCAAGAGGTACGGCGGGTTCTGCGCCCAGGGGGAGTGTTATTTTTCTGGGAGCACGTAGCCGAACCATACGGGTCATGGGCATTCATGTGGCAGCAGGTCTTCGAACCCACTTGGAAACACATCGGAGACGGCTGCTGTTTAACGCGGGAAACGTGGAAGGACTTGGAAAATGCACAGTTTAGCGAAATTCAGATGGAAAGACAACCCCCCCCGCTGAAATGGTTGCCTGTAGGCCCGCATATTATGGGCAAAGCCGTCAAGACGCGT • Restriction sites available are the upstream BamHI (934) and downstream EcoRI (944) sites • BamHI recognition sequence: GGATCC • EcoRI recognition sequence: GAATTC • Will use overhang PCR to introduce restriction sites as well as extra stop codons after the gene sequence

22. Forward Primer Design Forward Primer: • METTL7B Starting sequence: ATGGATATTTTAGTGCCA • Primer Sequence: 5’ CTAGCTAGGGATCCAGATGGATATTTTAGTGCCA 3’ BamHI Site METTL7B Sequence Helps BamHI Bind to DNA Maintain ATG Start Codon in Frame

23. Reverse Primer Design Reverse Primer: • METTL7B Ending sequence: AAAGCCGTCAAGACGCGT • Primer Sequence: 5’ ATGGGAAAGGCTGTCAAATAATAAGAATTCCTAGCTAG 3’ Reverse Complement: (This one will bind in correct orientation) 5’ CTAGCTAGGAATTCTTATTATTTGACAGCCTTTCCCAT 3’ EcoRI Site METTL7B Sequence 2X Stop Codon Helps EcoRI Bind to DNA

24. PCR Annealing Temperature Optimization 57 oC Annealing Temp: 42 oC 47 oC 54 oC • Lower annealing temperature results in better efficiency amplification • Also results in more off target binding and multiple PCR products • Can see this in other bands present in 42 oC and 47 oC lanes

25. Plasmid Backbone Restriction Digest • Reminders: • Uncut plasmid is 4952 base pairs • Restriction should remove 10 base pairs • Lane 1 contains the uncut plasmid • Why is it smaller than expected? • Lanes 2, 4, 6, and 8 contain the cut plasmid. • Require multiple lanes to gel purify backbone. • Lanes 3, 5, 7, and 9 contain digested PCR product. • Can’t observe change in nucleotide base pairs. • Can confirm enzymes didn’t cut in the middle.

26. Finch TV • Go to example

27. Clustal Omega • Multiple sequence alignment • Useful to examine sequencing data for presence of SNPs or frameshift mutations. • Not all PCR is perfect • Risk of mutation increases with length of PCR amplification • Use of high fidelity enzymes mitigates the risk • Might be better/easier tools in other sequencing viewer software. This is just how I do it.

28. Conclusions • Lots of online tools and guides for workflow and design aspects for cloning • Kits for every possible cloning thing you want to do • Not all companies make the same quality kits • Personal favorite is Qiagen but New England Biolabs kits have worked before • UW Biochem Stores in J-wing basement sells all the kits you need • Plan out all the design before synthesizing primers • Really annoying to have to re-submit a synthesis order because you messed up • Ask for help! Multiple people looking at primer design or digestion sites might find problems that were overlooked.