bioinformatics on genomics n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Bioinformatics On Genomics PowerPoint Presentation
Download Presentation
Bioinformatics On Genomics

Loading in 2 Seconds...

play fullscreen
1 / 40

Bioinformatics On Genomics - PowerPoint PPT Presentation


  • 84 Views
  • Uploaded on

Bioinformatics On Genomics. Hsueh-Fen Yuki Juan April 28, 2003. Outline. Gene Sequence Searching Cutting Site for a Specific Sequence Sequence Alignment Search for Conserved Domains ORF Finding. Gene Sequence Searching Cutting Site for a Specific Sequence Sequence Alignment

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Bioinformatics On Genomics' - zora


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
bioinformatics on genomics

Bioinformatics On Genomics

Hsueh-Fen Yuki Juan

April 28, 2003

outline
Outline
  • Gene Sequence Searching
  • Cutting Site for a Specific Sequence
  • Sequence Alignment
  • Search for Conserved Domains
  • ORF Finding
slide3
Gene Sequence Searching
  • Cutting Site for a Specific Sequence
  • Sequence Alignment
  • Search for Conserved Domains
  • ORF Finding
slide4

Gene Sequence Searching

Accession Number

Gene Sequence

http www ncbi nlm nih gov unigene
http://www.ncbi.nlm.nih.gov/UniGene/

AA046701

AA069414

AA070289

AA446013

AA425102

slide8

GGGGGGGGGAAGCTGAGCGCTGAGACCAAGGGCTAAAGCTGGGAGACTGAAAAAATGCAG

ACCGCCGGGGCATTATTCATTTCTCCAGCTCTGATCCGCTGTTGTACCAGGGGTCTAATC

AGGCCTGTGTCTGCCTCCTTCTTGAATAGCCCAGTGAATTCATCTAAACAGCCTTCCTAC

AGCAACTTCCCACTCCAGGTGGCCAGACGGGAGTTCCAGACCAGTGTTGTCTCCCGGGAC

ATTGACACAGCAGCCAAGTTTATTGGTGCTGGGGCAGCCACAGTTGGTGTGGCTGGTTCA

GGGGCTGGCATTGGAACCGTGTTTGGCAGCTTGATCATTGGCTATGCCAGGAACCCGTCT

CTCAAGCAGCAGCTCTTCTCCTATGCCATTCTTGGCTTTGCCCTGTCTGAGGCCATGGGG

CTTTTCTGTTTGATGGTCGCCTTCCTCATCCTCTTCGCCATGTGAGGCTCCATGGGGGGT

CACCGGCCTGTTGCTACTGCAACTCCACACCATTCTTGGTGCTGGGGTGTGTTAAGCTTT

ACCATTAAACACAACGTTTCTCTAAAAAAAAAAAAAAAAAAAAC

slide9
Gene Sequence Searching
  • Cutting Site for a Specific Sequence
  • Sequence Alignment
  • Search for Conserved Domains
  • ORF Finding
cutting site for a specific sequence
Cutting Site for a Specific Sequence

Sequence

  • Cut by Restriction Enzymes
  • RestrictionMapper
  • REBASE
  • NEBcutter
  • DARWIN
slide11

RestrictionMapper

http://www.restrictionmapper.org

slide14

REBASE

Rebase.neb.com/

rebase.html

slide19

DARWIN

http://darwin.bio.geneseo.edu/~yin/

WebGene/RE.html

slide20
Gene Sequence Searching
  • Cutting Site for a Specific Sequence
  • Sequence Alignment
  • Search for Conserved Domains
  • ORF Finding
  • Primary Structure Analysis: Amino acid composition, pI and MW
  • Protein Sequence Searching
  • Proteomics Tools
slide21

Sequence Alignment

InputQuery

DNA Sequence

Amino Acid Sequence

blastx

tblastx

blastn

Blastp

tblastn

Compares Against Translated Nucleotide Sequence Database

Compares Against protein Sequence Database

Compares Against protein Sequence Database

Compares Against Translated Nucleotide Sequence Database

Compares Against Nucleotide Sequence Database

slide32
Gene Sequence Searching
  • Cutting Site for a Specific Sequence
  • Sequence Alignment
  • Search for Conserved Domains
  • ORF Finding
slide36
Gene Sequence Searching
  • Cutting Site for a Specific Sequence
  • Sequence Alignment
  • Search for Conserved Domains
  • ORF Finding
slide37

ORF Finder

(Open Reading Frame Finder)

http://www.ncbi.nlm.nih.gov/gorf/

useful bio websites
Useful Bio-Websites

euGene

http://iubio.bio.indiana.edu:8089/

Proteome Analysis @EBI

http://www.ebi.ac.uk/proteome/

GeneCards

http://genecards.ym.edu.tw/