140 likes | 509 Views
Ch. 12.4 Mutations. Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations on cells and organisms. Mutations. Any change in DNA sequence is called a mutation .
E N D
Ch. 12.4 Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations on cells and organisms.
Mutations • Any change in DNA sequence is called a mutation. • can be caused by errors in replication, transcription, cell division, or by external agents. • If mutation occurs in gametes (sex cells) it will be passed on to offspring • may produce a new trait or it may result in a protein that does not work correctly. the mutation results in a protein that is nonfunctional, and the embryo may not survive In some rare cases a gene mutation may have positive effects.
Mutations • If mutation takes place in a body cell, it is not passed on to organism’s offspring • Damage to a gene may impair the function of the cell • When that cell divides, the new cells also will have the same mutation • Some mutations of DNA in body cells affect genes that control cell division. • This can result in the cells growing and dividing rapidly, producing cancer.
TACGCACATTTACGTACG DNA aa aa aa aa aa aa aa AUGCGUGUAAAUGCAUGC mRNA protein trait Mutations • Changes to DNA are called mutations • change the DNA • changes the mRNA • may change protein • may change trait
Types of mutations • Changes to the letters (A,C,T,G bases) in the DNA • point mutation • change to ONE letter (base) in the DNA • may cause change to protein, may not • frameshift mutation • addition of a new letter (base) in the DNA sequence • deletion of a letter (base) in the DNA • both of these shift the DNA so it changes how the codons are read • big changes to protein!
Point Mutations • One base change • can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this changethe sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATENDTHEREDRATRAN
Point Mutations • Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Doesthis changethe protein? DEPENDS… AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop
Sickle cell anemia • Hemoglobin protein in red blood cells • strikes 1 out of 400 African Americans • limits activity, painful & may die young Normalround cells Misshapensickle cells Only 1 out of146 amino acids
Point Mutations • Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this changethe protein? Why not? The code hasrepeats in it! AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop
Point Mutations • Nonsense mutation = change to STOP AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Really destroyedthat protein! AUGCGUGUAUAAGCAUGCGAGUGA MetArgValStop
Frameshift Mutations • Add or delete one or more bases • changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this changethe sentence? A LOT! Delete one! Add one! THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN
Frameshift Mutations • Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this changethe protein? A LOT! AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA
Frameshift Mutations • Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop Does this changethe protein? A LOT! AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA
Causes of Mutations • sometimes a mistake in base pairing during DNA replication. • many mutations are caused by factors in the environment • Any agent that can cause a change in DNA is called a mutagen. • Mutagens include radiation, chemicals, and even high temperatures