Sox2 consensus site: CATTGT G The transcriptional response element: - PowerPoint PPT Presentation

xue
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Sox2 consensus site: CATTGT G The transcriptional response element: PowerPoint Presentation
Download Presentation
Sox2 consensus site: CATTGT G The transcriptional response element:

play fullscreen
1 / 1
Download Presentation
Sox2 consensus site: CATTGT G The transcriptional response element:
77 Views
Download Presentation

Sox2 consensus site: CATTGT G The transcriptional response element:

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Supplemental figure 1 Sox2 TRE reporter construct A. Sox2 consensus site: CATTGTG The transcriptional response element: TAATTAATGCAGAGACTCTAAAAGAATTTCCCGGGCTCGGGCAGCCATTGTGATGCATATAGGATTATTCACGTGGTAATG The Sox2 reporter construct sequence: 5’TAATTAATGCAGAGACTCTAAAAGAATTTCCCGGGCTCGGGCAGCCATTGTGATGCATATAGGATTATTCACGTGG TAATGTAATTAATGCAGAGACTCTAAAAGAATTTCCCGGGCTCGGGCAGCCATTGTGATGCATATAGGATTATTCACGTGGT AATG CCAGTCCAAGCTAGGCAGGTTCCCCTCTAATTAATGCAGAGACTCTAAAAGAATTTCCCGGGCTCGGGCAGCCATTGT GATGCATATAGGATTATTCACGTGGTAATGAGCACAGTCGACAGTTCTTGC-3’ B. C.