slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Sox2 consensus site: CATTGT G The transcriptional response element: PowerPoint Presentation
Download Presentation
Sox2 consensus site: CATTGT G The transcriptional response element:

Loading in 2 Seconds...

play fullscreen
1 / 1

Sox2 consensus site: CATTGT G The transcriptional response element: - PowerPoint PPT Presentation

  • Uploaded on

Supplemental figure 1. Sox2 TRE reporter construct. A. Sox2 consensus site: CATTGT G The transcriptional response element: TAATTAATGCAGAGACTCTAAAAGAATTTCCCGGGCTCGGGCAGC CATTGTG ATGCATATAGGATTATTCACGTGGTAATG The Sox2 reporter construct sequence:

I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
Download Presentation

Sox2 consensus site: CATTGT G The transcriptional response element:

An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

Supplemental figure 1

Sox2 TRE reporter construct


Sox2 consensus site: CATTGTG

The transcriptional response element:


The Sox2 reporter construct sequence:





