wyman
Uploaded by
53 SLIDES
696 VIEWS
540LIKES

Understanding DNA Structure and Replication: Blueprint of Life

DESCRIPTION

This comprehensive overview delves into the intricacies of DNA, an essential molecular blueprint for all living organisms. It explains the fundamental concepts of chromosomes, heredity, and traits, highlighting key discoveries that led to our understanding of DNA's structure. From Rosalind Franklin's pioneering X-ray crystallography to the famous Watson and Crick model, the text elucidates the double helix's formation, the role of nucleotides, and the process of DNA replication. Essential for understanding genetics, this topic emphasizes how traits are passed from parents to offspring through DNA.

1 / 53

Download Presentation

Understanding DNA Structure and Replication: Blueprint of Life

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Welcome Back! Vocabulary Do Now • Chromosomes: strands of DNA wrapped around proteins and coiled tightly • Define the following in your own words • DNA • Heredity • Traits

  2. Unit 4.1 DNA Structure and Replication

  3. A. Discovery of DNA structure • Many scientists worked to determine the source of heredity • Heredity: the passing of traits from parent to offspring • How are these traits passed on? • First scientists determined that chromosomes controlled heredity and are made of DNA and proteins • Then scientists determined that DNA was the chemical that controlled characteristics (traits) of the organisms • Then the race was on to reveal the chemical structure of the DNA molecule

  4. A. Discovery of DNA structure • Rosalind Franklin was the first to take a clear “picture” of DNA using X-ray crystallography. The “picture” offered a clue of the shape of DNA. • Watson and Crick received credit for finalizing the model of DNA by using the picture taken by Franklin.

  5. B. DNA- the Blueprint of Life • DNA stands for deoxyribonucleic acid. • DNA is the blueprint for life. Every living thing uses DNA as a code for making proteins which determine traits. • Ex: DNA contains the instructions for making the proteins (called pigments) which give your eyes color.

  6. B. DNA- the Blueprint of Life • DNA is packaged into chromosomes • strands of DNA wrapped around proteins and coiled tightly • Chromosomes are found in the nucleus of eukaryotic cells. Prokaryotic cells have chromosome free-floating in the cytoplasm.

  7. C. Structure of the DNA molecule • DNA is composed of two strand that are twisted together in a double helix. A double helix is a twisted ladder. • The building blocks of DNA are called nucleotides. A nucleotide consists of three parts: • A sugar (named deoxyribose). • A phosphate group. • A nitrogen base. There are four possible nitrogen bases in a DNA molecule: • Adenine (A) Thymine (T) • Guanine (G) Cytosine (C)

  8. C. Structure of the DNA molecule Hydrogen Bond • The sides of the ladder are made of sugar and phosphate. The rungs of the ladder are the nitrogen base pairs. • The nucleotides are arranged into two strands that are held together by weak hydrogen bondsbetween the nitrogen bases. • The nitrogen bases bond in a specific way • Adenine – Thymine (A-T) • Guanine – Cytosine (G-C) • This pattern is called complementary base pairing

  9. Check Yourself

  10. D. DNA Replication If I started as one cell, how did all of my cells get a copy of DNA? • Because DNA is so important, when a cell divides, it must pass on an exact copy of the DNA to its daughter cells so they can function. • Therefore, DNA is copied (replicated) during interphase, (specifically the “S”-phase), immediately before the cell begins mitosis.

  11. E. Process of DNA Replication • An enzyme breaks the hydrogen bonds between the paired nitrogen bases. This allows DNA to “unzip” as the two strands move apart. • The newly unpaired nucleotides are paired (A-T and G-C) with extra nucleotides present in the nucleus. This process is catalyzed by another enzyme.

  12. E. Process of DNA Replication 3. Enzymes then link the nucleotides along the newly constructed side of the DNA ladder by bonding sugar to phosphate backbone. 4. The DNA is proofread by enzymes for any errors.

  13. F. Result of DNA replication • Two identical DNA molecules have been produced. • Each “daughter” DNA molecule is composed of one “old” strand and one “new” strand (semi-conservative). • Each copy of DNA is packaged as a chromatid on a doubled chromosome. • After mitosis, each daughter cell will receive one of the two copies of DNA. This happens when the doubled chromosome is split.

  14. Check Yourself

  15. DNA Cutout

  16. Welcome Back! • Turn in cut-out homework • Vocabulary Do Now • Codon:every three bases in a sequence of mRNA • Anticodon: three bases on tRNA • Gene: a section of DNA; used as the blueprint for making a protein; composed of a specific sequence of nucleotides • Polypeptide: a long chain of amino acids

  17. 4.2 Protein Synthesis

  18. Protein Synthesis A. Importance of Protein Synthesis • Every inherited trait is controlled by one or more proteins. • Protein synthesis is the process that makes those proteins • Each cell must produce different proteins, based on the function of that cell. • Ex: Only blood cells need to produce the protein hemoglobin. Hemoglobin

  19. B. DNA Controls the Production of Proteins. • A section of DNA, called a gene, is used as the blueprint for making a protein. • Each gene is composed of a specific sequence of nucleotides. • Sequence can be represented by writing the order of the N-Bases • Ex: DNA sequence of insulin  CCATAGCACGTTACAACGTGA • The cell knows what protein to make based on the sequence. Therefore the order of the bases matter!

  20. Proteins are made of amino acids. • Each codon directs the cell to place a specific amino acid in a particular protein as the protein is built. • For example, CAA in DNA codes for the amino acid “valine” • If this sequence was the third segment of a gene, valine would be the third amino acid in the chain

  21. C. Protein Synthesis Requires RNA • RNA is made up of a single strand of nucleotides. • Nucleotides: sugar (ribose), phosphate, and a nitrogen base. • All RNA has a different sugar (ribose) which cannot bind to thymine. • Thus RNA must use a different nitrogen base (uracil) as a substitute for thymine • This means that in mRNA, A bonds with U NOT T • There are 3 types: • mRNA (messenger) • tRNA (transfer) • rRNA (ribosomal)

  22. A codon is every three bases in a sequence of mRNA. • A codon is like a single word in a sentence. • Only by putting the words (codons) in the correct order can you create a meaningful sentence (protein)

  23. When working on problems we use the “mRNA” codon to find the corresponding acid.

  24. DNA and the Workings of a Cell • Sequence 1 – Human C CATAGCACGT TACAACGTGAAGGTAA • Sequence 2 – Cow CCGTAGCATGTTACAACGCGAAGGCAC

  25. The Snorks More practice with codon charts!

  26. Vocabulary Do Now • DNA: Deoxyribonucleic acid • Nucleic acid; A molecule that encodes the genetic instructions used in the development and functioning of all known living organisms. • Nucleotides: Deoxyribose sugar, Phosphate, Nitrogen-bases (Guanine, Cytosine, Adenine, Thymine) • RNA: Ribonucleic acid  • Nucleic acid; plays an active role within cells by catalyzing biological reactions, controlling gene expression or sensing and communicating responses to cellular signals. One of these active processes is protein synthesis • Nucleotides: Ribose sugar, Phosphate, Nitrogen-bases (Guanine, Cytosine, Adenine, Uracil)

  27. Let’s Get To Work… • If you have not finished the following assignments, you must complete them by the end of the block today. • Nucleotide Cut Out • The Snorks • Assignments should be completed neatly and thoroughly. • You will be working INDEPENDENTLY. • If you have music, listen to it at a level that your other classmates CANNOT hear. • If you finish both assignments, see Ms. Fields

  28. Welcome Back! • Vocabulary Do Now: • The Central Dogma: • Describes the sequence in which information is passed to express your traits (controlled by protein). • Transcription: first step of protein synthesis • Purpose:to rewrite the DNA code as mRNA . • Translation: second step of protein synthesis • Purpose: use mRNA to build the protein.

  29. More practice with DNA and RNA • Egad! A new Snork was discovered on the planet Dee Enae • Your task is as follows: • Copy down the Snork’s DNA sequence • Translate into RNA sequence • Find the corresponding amino acids using your codon chart • Discover the new Snork’s phenotype • Draw him

  30. SwaggySnork • Gene 1: CAG TCG TTT • Gene 2: ATG GGG CTT CTC TTT • Gene 3: GAA GAG GAG GGG • Gene 4: CAA CGC CGA • Gene 5: GTG TAA • Gene 6: AGA GGG CAT • Gene 7: CTA TAA GAA GAC GGG TGT • Gene 8: CAA CTA CTA CGC • Gene 9: AAA AGA CCA • Gene 10: TCT ATA ACA

  31. Go Further • DNA/RNA Review Packet • Complete tonight for homework (if you do not finish in class) • YES it must be COLORED and YES you must ANSWER THE QUESTIONS

  32. Welcome Back • Vocabulary Do Now: • Gene Regulation is the process that determines which genes will be expressed (used to make a protein)

  33. The Central Dogma: the central axis around which all other biological concepts rotate • Describes the sequence in which information is passed to express your traits (controlled by protein). • DNA ---------------RNA ----------------Protein (Transcription) (Translation)

  34. D. Process of Protein Synthesis (two steps) Step 1: Transcription • Occurs in the nucleus. • Purpose: to rewrite the DNA code as mRNA . • DNA cannot leave the nucleus (it is too big) to go the ribosomes where proteins are made. • It must send the instructions using RNA

  35. Step 1: Transcription Steps: • 1. mRNA copies the DNA when the DNA unzips one section called a gene • One gene = one protein • 2. mRNA is constructed one nucleotide at a time using one side of the DNA as a template • 3. mRNA leaves the nucleus through a small opening in the nuclear membrane called a pore • 4. The DNA rezips the gene The protein is not yet synthesized! The code has been transcribed and needs to be translated!

  36. Step 2: Translation • Occurs in the ribosome. • Purpose: use mRNA to build the protein. • In the cytoplasm of the cell, translation occurs at the ribosome • Ribosomes are made of rRNA (ribosomal RNA) and proteins • The ribosome holds mRNA in place and helps link amino acids together to make a protein.

  37. Step 2: Translation Steps: • The mRNA enters the ribosome • The mRNA “start” codon (AUG) attaches to the ribosome • tRNA (transfer RNA) carries an amino acid to the ribosome • In order for the tRNA to leave the amino acid at the ribosome, the tRNA must bond with a complementary codon on the mRNA • The ribosome allows the tRNA anticodon to bond and the complementary codon on the mRNA to pair • tRNA anticodon: made of three bases at the bottom of each tRNA

  38. The amino acid is removed from the tRNA by an enzyme. • As each new amino acid arrives on a tRNA, amino acids are bonded together IN ORDER by a peptide bond to form a polypeptide • When the ribosome reaches a “stop” codon, it releases the mRNA and the string of amino acids separately • The string of amino acids folds and coils to shape the protein

  39. Check Yourself

  40. Exit Ticket: 3-2-1 • On index card: • 3 things you learned this week • 2 things you still have questions on • 1 comment for Ms. Fields • Work on: • Transcription/translation WS • What you don’t finish will be for homework • Have a great weekend!

  41. Result of Protein Synthesis • Cells respond to their environment by producing different types and amounts of protein • The cell produces proteins that are: • Structural: forming part of the cell materials • Functional: such as enzymes, hormones or chemicals in cell chemistry

  42. Welcome Back! • Turn in completed work • Transcription & Translation Worksheet • DNA – The Double Helix Worksheet • Snorks • Turn in bin = Ms. Fields desk

  43. To Do: • Test tomorrow! • Cell Division • Mitosis • Meiosis • To Do: • Review Sheet • Alien Protein Synthesis

  44. Result of Protein Synthesis • All of an organisms cells have the same DNA but the cells differ based on the expression of the genes • Multicellular organisms begin as undifferentiated masses of cells. Variation in DNA activities determine cell types. • Different types of cells expressing different genes leads to differentiation. • Only specific parts of the DNA are activated in those cells. • Once a cell differentiates, the process cannot be reversed. • Ex: we have muscle cells, nerve cells and others

  45. Result of Protein Synthesis • All of an organisms cells have the same DNA but the cells differ based on the expression of the genes • Gene Regulation is the process that determines which genes will be expressed (used to make a protein) • This can be affected by a cell’s history and/or environment • Proteins may be overproduced, under produced or produced at incorrect times • Ex: injury, repair, cancer

  46. Result of Protein Synthesis • Each individual in a sexually reproducing population has a slightly differing sequence of nucleotides in DNA when compared to other organisms of the same species • The different sequences lead to different proteins which produce different traits (i.e., variation) • Ex: two humans with different eye color

  47. 4. Gene regulation • All of an organism’s cells have the same DNA, but cells differ based on the expression of the genes. • Gene regulation is the process which determines which genes will be expressed (used to make a protein). • Different types of cells expressing different genes leads to cell specialization. • Ex: Muscle cells, skin cells, and nerve cells have very different functions but the same DNA. It depends on which genes are “turned on”.

More Related