slide1
Download
Skip this Video
Download Presentation
Expt. 10-1 : P-elements and Enhancer Trapping

Loading in 2 Seconds...

play fullscreen
1 / 29

Expt. 10-1 : P-elements and Enhancer Trapping - PowerPoint PPT Presentation


  • 146 Views
  • Uploaded on

Expt. 10-1 : P-elements and Enhancer Trapping. Expt. 10: P-elements and Enhancer Trapping. Naturally occurring P-elements: Transposase gene between two inverted repeats. Transposase. 31 bp Inverted Repeat. Tnp Binding Site. 9 or 21 bp Spacer. Organization of the P Element.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Expt. 10-1 : P-elements and Enhancer Trapping' - verdi


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide2
Expt. 10: P-elements and

Enhancer Trapping

  • Naturally occurring P-elements: Transposase gene between two inverted repeats

Transposase

organization of the p element
31 bp Inverted

Repeat

Tnp Binding

Site

9 or 21 bp Spacer

Organization of the P Element

Transposase ORF

2.9 kb P Element

slide4
NNNNNNNNNCATGATGAAATAACATA

NNNNNNNNN

3’-OH

5’-P

AGGTGG

GTACTACTTTATTGTATTCCACC

P -5’

HO-3’

Transposase catalyzes a 17bp staggered cleavage event

5’ Cleavage Site

NNNNNNNNNCATGATGAAATAACATAAGGTGG

NNNNNNNNNGTACTACTTTATTGTATTCCACC

3’ Cleavage Site

slide5
+

P Element

slide6
8 bp target site

duplication

P Element

P element integration generates an 8 bp target site duplication

slide8
Taking Advantage of P-elements

-Mutagenesis -Insertional mutations easy to clone.

slide9
Taking Advantage of P-elements
  • -Mutagenesis Insertional mutations (easy to clone).
      • Imprecise excisions lead to frameshifts
      • and deletions.
slide10
Taking Advantage of P-elements
  • Germline transformation
slide11
Taking Advantage of P-elements
  • -Mutagenesis
  • Germline transformation
    • 1.Design transgene with inverted repeats.
slide12
Taking Advantage of P-elements
  • -Mutagenesis
  • Germline transformation
    • 1.Design transgene with inverted repeats.
    • 2.Mix with transposase gene
slide13
Taking Advantage of P-elements
  • -Mutagenesis
  • Germline transformation
    • 1.Design transgene with inverted repeats.
    • 2.Mix with transposase gene
    • 3.Inject into germline of embryo
slide14
Taking Advantage of P-elements
  • Germline transformation
    • 1.Design transgene with inverted repeats.
    • 2.Mix with source of transposase
    • 3.Inject into germline of embryo
    • 4.Look for transformants in F1.

YFG

slide15
Taking Advantage of P-elements
  • -Mutagenesis
  • Germline transformation
  • Enhancer trapping Use regulatory information from nearby genes to drive expression of a transgene
slide16
Mechanics of Enhancer Trapping:
  • Modified P-element contains:
    • Inverted repeats
    • Basic promoter sequences
    • Molecular marker gene (e.g. b-galactosidase)
    • Phenotypic marker (e.g. w+, ry+)
  • Mobilize using transposase
  • Confirm hopping in F1 (phenotype)
  • Look for interesting/desired expression pattern in F2 with lacZ staining
slide17
Mechanics of Enhancer Trapping:
  • Modified P-element contains:
    • Inverted repeats
    • Basic promoter sequences
    • Molecular marker gene (e.g. b-galactosidase)
    • Phenotypic marker (e.g. w+, ry+)
  • Mobilize using transposase
  • Confirm hopping in F1 (phenotype)
  • Look for interesting/desired expression pattern in F2 with lacZ staining
slide19
Attached X females

^

XY X XXY

^

XXX Sterile

^

XXY Female

XY Male

YY Dead

slide21
+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+ Sco ryY + +

X

+ P[lacZ, ry+], CyKi D2-3, ry+XX + ry

Y+ ryY + ry

(phenotype=Cy, Ki, ry+)

slide22
+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+ Sco ryY + +

X

+ P[lacZ, ry+], CyKi D2-3, ry+XX + ry

Y +ryY + ry

(phenotype Cy, Ki, ry+)

^

X

^

slide23
+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+ Sco ryY + +

X

+ P[lacZ, ry+], CyKi D2-3, ry+XX + ry

Y +ry Y + ry

(Cy, Ki, ry+)

^

X

+P?+P?ryP?XX + ry

Y + ry Y + ry

(not Cy, not Ki. If carrying

a jumped P, will be ry+)

^

slide24
+ P[lacZ, ry+], Cy ry+ + Ki D2-3, ry+

+ Sco ryY + +

X

+ P[lacZ, ry+], CyKi D2-3, ry+XX + ry

Y +ry Y + ry

(Cy, Ki, ry+)

^

X

+P?+P?ryP?XX + ry

Y + ry Y + ry (not Cy, not Ki. If carrying

a jumped P, will be ry+)

^

X

Stain F2 for lacZ

Look for desired

expression pattern

slide26
The Ovariole

Germarium

Germarium

slide28
The Egg Chamber

Nurse Cells

Oocyte,

follicle cells

slide29
Staining Ovaries

Schematic Summary

  • Dissect ovaries out of abdomen in NaPO4 buffer (movie!).
  • Devitallinize with heptane
  • Fix ovaries and wash
  • Add X-GAL, the substrate for b-galactosidase.
  • Wash when dark enough, and observe.
  • We are using enhancer traps that express in
    • Follicle cells
    • Nurse cells and oocyte
ad