varen
Uploaded by
122 SLIDES
1649 VIEWS
1240LIKES

Gene expression regulation ***

DESCRIPTION

Gene expression regulation ***. Enmin Li. Section 1 ** Basic concept, specificity and modality of gene expression Section 2 ** Basic principle of gene expression regulation Section 3 ** Regulation of gene expression in prokaryote

1 / 122

Download Presentation

Gene expression regulation ***

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Gene expression regulation *** Enmin Li

  2. Section 1** Basic concept, specificity and modality of gene expression • Section 2** Basic principle of gene expression regulation • Section 3** Regulation of gene expression in prokaryote • Section 4** Regulation of gene expression in eukaryote

  3. Section 1 The basic concept, specificity and modality of gene expression

  4. 1.1 The concept of gene expression gene expression =+ translation transcription

  5. 1 proteins 2 RNAs 1 proteins 2 RNAs DNAs RNAs Proteins Interaction among large biomolecules

  6. 1.2 The specificity of gene expression in the time and the space

  7. 1.2.1 The temporal specificity of gene • expression • The temporalspecificity is that some specific genes in genome are expressed in order ofspecific time • The temporalspecificity is alsostage specifi-city in the polycellular biosomes • The expressed genes in early developmental steps are more than in other steps in polycellular biosomes • The expressed genes relate with biological function.

  8. 1.2.2 The spatial specificity of gene • expression • In the polycellular biosomes the spatial speci- ficity of gene expression is that one or some specific genes in the genome are expressed in different systems, organs, tissues and cellsin order of space. • The spatial specificity of gene expression is also known as tissue specificity or cell specificity. • The expressed genes relate with biological function.

  9. 1.3 Modality of gene expression 1.3.1 Constitutive gene expression 1.3.2 Inductive and repressive gene expression

  10. 1.3.1 constitutive gene expression Some genes in genome are known as housekeeping genes.  The expression of housekeeping genes in genome are also called constitutive gene expression.  Constitutive gene expressionis continual in most cells.

  11.  The expressive products ofconstitutive genes are absolutely necessary in all over life process.  The expression of constitutive genes are less effected by environment factors.  The constitutive gene expression are only effected by interacting between promoter and RNA polymerase.

  12. 1.3.2 Inductive and repressive gene expression  The expression of some genes in genome are more effected by environment factors.  The increase of gene expression which is effected by environment factors are called induction, in contrast, the decrease of that are repression.

  13.  The expression of induced or repressed genes are regulated by other factors, besides interaction between promoter and RNA polymerase.  The special elements are located in the regulation region of induced or repressed genes.  Induction and repression of gene expression correspond with each other.

  14. 1.4 Biological significance of gene expression regulation  acclimation  keep growth and proliferation  keep individual development and differentiation

  15. Section 2 Basic principle of gene expression regulation

  16. 2.1 multilevel regulation of gene expression • check point • activity of gene structure in genome • DNA amplification • DNA rearangement • DNA methylation • initiation of RNA transcription* •  process of RNA post-transcription •  transport of RNA post-process •  initiation of protein translation •  process of protein post-translation

  17. 2.2 basic factors of gene expression regulation specific DNA sequence regulation protein RNA polymerase

  18. 2.2.1 specific DNA sequence transcriptional initiation site 2.2.1.1 promoter of prokaryotic genes “TTGACA” “TATAAT” spacer +1 spacer N17 N7 TTGACA TTAACT A trp N16 N7 tRNATyr TTTACA TATGAT A N17 N6 TTTACA TATGTT A lac N16 N7 TTGATA TATAAT A recA N18 N6 CTGACG TACTGT A ara BAC -35 region -10 region consensus sequence

  19. 2.2.1.2 the prokaryotic operon  The concept of the operon was first proposed in 1961 by Jacob and Monod.  An operon is a whole unit of prokaryotic gene expression which includes a set ofstructural genes and its promoter, operator and other control elements which are recognized and bond by regulatory gene products.

  20. i gene region Structural genes region Regulatory region 3’ 5’ Gene 1 Gene 2 Gene 3 Inhibitor gene p O  The operator is a site bond with the repressor. The operator mediates a negative regulation of operon.  The operator is next to the promoter.  The operator sites in downstream of the promoter. The operator overlaps partly with the promoter some time. RNA polymerase repressor

  21. 2.2.1.3 Other regulator of prokaryotic operons  special DNA sequence in some prokaryotic operons  can bind with activator of RNA polymerase  increase transcription of operons  mediate positive regulation of operons The positive regulation is not main mechanism about gene expression regulation of operons, but the negative regulation is .

  22. 2.2.1.4 cis-acting elements of eukaryotic gene The cis-acting elements are DNA fragments.  The cis-acting elements are the regulator of eukaryotic gene transcription  There are cis-acting elements in the flakings or the introns of eukaryotic gene.  The cis-acting elements include promoter,enhancer, silencer and so on.

  23. 3’ exon intron exon 5’ silencer enhancer enhancer promoter gene coding region silencer The eukaryotic genes are monocistron.  there are not the operons structure in eukaryotic genome RNA polymerase

  24. 2.2.2 regulation protein 2.2.2.1 regulation protein of prokaryotic genes  specific factors: decide identification and bind between RNA polymerase and specific promoter  repressor: bind operator and repress gene transcription  activator: bind a special DNA sequence next to promoter advance to bind between RNA polymerase and promoter and to form transcription initiation complex.

  25. 2.2.2.2 regulation protein of eukaryotic genes transcription factor, it is also trans-acting factor.  cis-acting protein protein A trans-acting protein trans-acting factor trans-regulation PA A PB B protein B cis-acting protein cis-regulation

  26. 2.2.3 RNA polymerase 2.2.3.1 promoter of prokaryotes/eukaryotes effect on RNA polymerase  The promoter of prokaryotes/eukaryotes is consist of transcription initiation site, RNA polymerase identification and binding site and other regulation elements.  The promoter of eukaryotes is more complicated than that of prokaryotes.

  27.  The sequence of different promoter is certain different.  The affinity of prokaryotic promoter with RNA polymerase effects directly on frequency of gene transcription initiation The affinity between eukaryotic RNA polymerase and promoter is less, when RNA polymerase is single.  The eukaryotic RNA polymerase can bind with promoter after forming complex with basic transcription factor.

  28. 2.2.3.2 regulation proteins effect on activity of RNA polymerase  Specific promoter decides basic transcription frequency of genes.  The regulation proteins can changetranscription frequency of genes.  The conformation or the expression level in the cell of regulation proteins gets a change under stimulation of environment signal.

  29. 2.2.4 DNA-protein and protein-protein interaction in transcription regulation of eukaryotic genes 2.2.4.1DNA-protein interaction Identificationand bind between cis-acting proteins or trans-acting factors and cis-acting elements  Its interaction is a non-covalent bond.  Form DNA-protein complex finally

  30. 2.2.4.2 protein-protein interaction  The most regulation protein can form homodimer, heterodimer, homopolymer or heteropolymer before binding with cis-acting element.  Ability of some regulation protein to bind with its cis-acting element is increased or decreased after polymerization. Some regulation protein don’t bind with DNA, but can effect the activity binding between DNA and other regulation protein by protein-protein interaction.

  31. Section 3 Regulation of prokaryotic gene expression 3.1 Characters of transcribed regulation in prokaryotic genes 3.2 Regulation of transcribed initiation in prokaryotic genes 3.3 Regulation of transcribed termination in prokaryotic genes 3.4 Regulation of proteic translation in prokaryote

  32. 3.1 characters of transcriptional regulation • in prokaryotic genes • 3.1.1 The function of  factors • The  factors bind a special element in 5’ flaking region of genes in the stage of transcribed initiation • The  factors decide the specificity of transcribed genes • The  factors mediate holoenzyme of RNA polymerase binding to specific promoter of genes • Different factors decide transcription of different genes.

  33. 3.1.2 universality of operon model  the most prokaryotic genes  There are many operons in orderin prokaryotic genome. Don’t discover operon in eukaryotic genome. 3.1.3 universality of repression mechanism  The repression mechanism is the main mechanism of transcriptional regulation of prokaryotic genes

  34. 3.2 regulation of transcribed initiation in prokaryotic genes

  35. 3.2.1 stucture of lactose operon i gene region base pair: 100bp 760bp 810bp 1000bp 3520bp regulatory region 30 32 structural genes region 37 135 3’ 5’ peptide : (MW kDa) Inhibitor gene C p O Gene Z Gene Y Gene A repressor (4 polymer) -galactosidase (4 polymer) - galactoside transacetylase(2 polymer) lactose permease (2 polymer) lactose lactose galactose + acetyl CoA acetylgalactose glucose cell + galactose

  36. Primary structure of lac operon regulation region Catabolite gene activation protein site 5’ ACTCGATTGAGTGTAATTA CTCATTAGG RNA polymerase binding region or promoter region CACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGAGCGGA -10 site -35 site TAACAATTTCACAC Operon region 5’ TATAAT 3’ Pribnow box 20bp 3’

  37. 3.2.2 regulated mechanism of lac operon genes 3.2.2.1 repressor regulate negatively transcription of lac operon genes p o RNA polymerase i z y a repressor (4 polymer) p o RNA polymerase i z y a galactose + mRNA repressor (4 polymer)

  38. 3.2.2.2 catabolite gene activation protein(CAP) regulate positively transcription of lac operon genes 5’ 3’ CAP site -10 -35 1 CAP CAP cAMP cAMP RNA polymerase -10 -35 at glucose presents CAP + cAMP at glucose absents

  39. 3.2.3 correspond between negative regulation of repressor and positive regulation of CAP in gene transcription control of lac operon 3.2.3.1 glucose concentration is lower and lactose concentration is higher RNA polymerase 5’ 3’ CAP CAP cAMP cAMP CAP site inhibitor gene -10 -35 0 at glucose absents Repressor (4 polymer) + galactose CAP + cAMP

  40. 3.2.3.2 glucose concentration is higher and lactose concentration is lower RNA polymerase 5’ 3’ CAP site inhibitor gene -10 -35 0 CAP cAMP Repressor (4 polymer) at glucose presents CAP + cAMP

  41. The negative regulation mechanism of the repressor cooperate with the positive regulation mechanism of the CAP control gene transcription of lac operon by kind and concentration of carbohydrate from the environment.

  42. 3.3 regulation of transcribed termination in prokaryotic genes

  43. 3.3.1 Dependent upon  factor RNA polymerase Promoter Terminator Gene 5’ 5’ c c c c c c c c c c   new RNA

  44. 3.3.2 model about transcription termination for independent to  factor RNA polymerase coding strand 5’ 5’ 5’ template strand new RNA transcript

  45. terminator DNA 5’…GCCGCCAGTTCGGCTGGCGGCATTTT… 3’ RNA 5’…GCCGCCAGUUCGGCUGGCGGCAUUUU…3’ C • The signals that terminates transcri-ption are localized in the gene 3’ end. • A simple termination signal is a GC- rich region that is a palindrome, followed by AT-rich sequence. • The RNA made from the DNA palindrome is self-complementary and so formed a internal hairpin structure followed by a few U bases. G U U G G AC C G C C G C UG G C G G C 5’ A U U U U-OH 3’

  46. p Attenuater O Trp operon R L E D C B A Synthesis of tryptophan in E. coli COOH HO Anthranilic acid NH2 Anthranilic acid synthetase O C COOH H2C NH2 Indoglycerol phosphate synthetase OH CH CH CH2 OH CH N COOH Tryptophan synthetase N Chorismic acid CH2 O P Indolglycerol phosphate Tryptophan 3.3.3 attenuationregulation mechanism of gene transcription of trp operon in E.coli

  47. The regulation mechanism of trp operon at a lot of tryptophans present p O R L E D C B A Inactive repressor at a few tryptophans present or tryptophans absent p O R L E D C B A Trp RNA polymerase + whole mRNA Repressor or Inactive repressor fragmentary mRNA

  48. tryptophans absent ribosome M K A RNA polymerase I 3 2 F RNA L K G 1 4 Try code DNA M K lot of tryptophans A RNA polymerase ribosome I F L K G W 4 3 W RNA R 1 2 Try code DNA

  49. 3.4 regulation of proteic translation in prokaryote

  50. 3.4.1 autoregulation/autogenous control DNA started region mRNA 5’ 3’ same mRNA Protein

More Related