struktur lis genomika n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Strukturális genomika PowerPoint Presentation
Download Presentation
Strukturális genomika

Loading in 2 Seconds...

play fullscreen
1 / 41
unity-bonner

Strukturális genomika - PowerPoint PPT Presentation

71 Views
Download Presentation
Strukturális genomika
An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Strukturális genomika Gyakorlati feladatok

  2. SNP-k és vizsgálatuk

  3. SNP-k és vizsgálatuk

  4. SNP-k és vizsgálatuk

  5. SNP-k és vizsgálatuk

  6. SNP-k és vizsgálatuk

  7. SNP-k és vizsgálatuk

  8. SNP-k és vizsgálatuk

  9. (wt) • CGT AGT CCT TGA AGC TAT ……………… TAT GTA CGT AGC TGA • (m) • CGT AGT CCT TGA AGC TAC ……………… TAT GTA CGT AGC TGA Allél specifikus amplifikáció - ASA

  10. (wt) • CGT AGT CCT TGA AGC TAT ……………… TAT GTA CGT AGC TGA • (m) • CGT AGT CCT TGA AGC TAC ……………… TAT GTA CGT AGC TGA Allél specifikus amplifikáció - ASA

  11. (wt) • CGT AGT CCT TGA AGC TAT ……………… TAT GTA CGT AGC TGA • (m) • CGT AGT CCT TGA AGC TAC ……………… TAT GTA CGT AGC TGA • Tervezzünk primerpárt! Allél specifikus amplifikáció - ASA

  12. (wt) • 5’ CGT AGT CCT TGA AGC TAT ……………… TAT GTA CGT AGC TGA3’ • 3’GCA TCA GGA ACT TCG ATA .…………….. ATA CAT GCA TCG ACT5’ • (m) • 5’ CGT AGT CCT TGA AGC TAC ……………… TAT GTA CGT AGC TGA3’ • 3’GCA TCA GGA ACT TCG ATG .…………….. ATA CAT GCA TCG ACT5’ • Hány primerre lesz szükségünk? Allél specifikus amplifikáció - ASA

  13. (wt) • 5’ CGT AGT CCT TGA AGC TAT ……………… TAT GTA CGT AGC TGA3’ • 3’GCA TCA GGA ACT TCG ATA .…………….. ATA CAT GCA TCG ACT5’ • (m) • 5’ CGT AGT CCT TGA AGC TAC ……………… TAT GTA CGT AGC TGA3’ • 3’GCA TCA GGA ACT TCG ATG .…………….. ATA CAT GCA TCG ACT5’ • Hány primerre lesz szükségünk? 3 Allél specifikus amplifikáció - ASA

  14. (wt) • 5’ CGT AGT CCT TGA AGC TAT……………… TAT GTA CGT AGC TGA3’ • 3’GCA TCA GGA ACT TCG ATA .…………….. ATA CAT GCA TCG ACT5’ • (m) • 5’ CGT AGT CCT TGA AGC TAC ………… TAT GTA CGT AGC TGA3’ • 3’GCA TCA GGA ACT TCG ATG .………… ATA CAT GCA TCG ACT5’ Allél specifikus amplifikáció - ASA

  15. (wt) • 5’ CGT AGT CCT TGA AGC TAT……………… TAT GTA CGT AGC TGA3’ • 3’GCA TCA GGA ACT TCG ATA .…………….. ATA CAT GCA TCG ACT5’ • (m) • 5’ CGT AGT CCT TGA AGC TAC ………… TAT GTA CGT AGC TGA3’ • 3’GCA TCA GGA ACT TCG ATG .………… ATA CAT GCA TCG ACT5’ Allél specifikus amplifikáció - ASA

  16. FAST PCR • Ellenőrzés: MultAlin • www.multalin.toulouse.inra.fr/multalin/multalin.html • Reverz primer ellenőrzéséhez • www.bioinformatics.org/SMS/rev_comp.html Primer tervezés programmal

  17. (wt) CGT AAT GAA TTC AGT TGC EcoRI akcióban Emésztés RE-vel

  18. (m) CGT AAT GAA CTC AGT TGC EcoRI akcióban SNP van az RE helyen

  19. (m) CGT AAT GAA CTC AGT TGC EcoRI akcióban Emésztés RE-vel

  20. Gélelektroforézis

  21. m wt Gélelektroforézis

  22. Mutáció az MLH1 gén 3. exon 5’ végén az ESE-ben Exon 2 Exon 1 Exon 3 ESE

  23. Mutáció az MLH1 gén 3. exon 5’ végén az ESE-ben • Mi történik az RNS érés során? És mi történne, ha nem lenne mutáció? Exon 2 Exon 1 Exon 3 ESE

  24. Mutáció az MLH1 gén 3. exon 5’ végén az ESE-ben Exon 2 Exon 1 Exon 3 Exon 2 Exon 1 Exon 3 ESE

  25. 5 tagú DNS könyvtár (mi a DNS könyvtár?) • Állítsuk sorba a tagjait (mi a módszer alapja?) • AGT TGA ………GCT CGT GAA • GTA CGT AGT ….CGT TGC CGT • GTG AAT…..CGT AGT • TAG TAG CTT…..CTG TAC GTA • CGT ATG ….TGA AGT Kromoszóma séta PCR-ral

  26. 5 5 2 2 3 3 6 6 4 4 1 1 2.: ligálás plazmid vektorba 1.: emésztés restrikciós endonukleázzal 1 2 3 4 5 6 Genomkönyvtár készítés

  27. 5 5 2 2 3 3 6 6 4 4 1 1 2.: ligálás plazmid vektorba 3.: transzformáció Escherichia coli-ba Genomkönyvtár készítés

  28. Milyen sorrend olvasható le a gélfotóról? • Melyik DNS band melyik szekvenciával azonosítható? GGCCATGGCCATCGTGGCCATCGTT GGCCAGGCCATCGTTGA GGCGGCCGGCCATC GGCCATCGGGCCATCGTTG n ACGT 10987654321 Sanger-módszer

  29. Milyen sorrend olvasható le a gélfotóról? • Melyik DNS band melyik szekvenciával azonosítható? GGCCATGGCCATCGTGGCCATCGTT GGCCAGGCCATCGTTGA GGCGGCCGGCCATC GGCCATCGGGCCATCGTTG n ACGT 10987654321 A3’GTTGCTACC5’ Sanger-módszer

  30. A leolvasott szekvencia alapján mi a templát DNS bázissorrendje? n ACGT A3’GTTGCTACC5’ 10987654321 Sanger-módszer

  31. A leolvasott szekvencia alapján mi a templát DNS bázissorrendje? • GGTAGCAACT n ACGT A3’GTTGCTACC5’ 10987654321 Sanger-módszer

  32. A pirogram alapján milyen sorrendben követték egymást a nukleotidok? • Mi a templát DNS bázissorrendje? Piroszekvenálás

  33. A pirogram alapján milyen sorrendben követték egymást a nukleotidok? G C T A • Mi a templát DNS bázissorrendje? Piroszekvenálás

  34. A pirogram alapján milyen sorrendben követték egymást a nukleotidok? G C T A • Mi a templát DNS bázissorrendje? CGTCCGGA Piroszekvenálás

  35. KRASonkogén 12p12 • RAS család tagja, GTPáz • 21kD-s fehérjét kódol (p21ras, vagy K-Ras) • K-Ras funkció:molekuláris kapcsoló • intracelluláris jelutak szabályozása • pl: EGFR közvetítette jelátvitel során „downstream”jelátviteli affektor. KRASgén analízis piroszekvenálással

  36. A KRAS gén BIOMARKER • Jelzi, hogy hogyan fognak reagálni a betegek a kezelésre • Szabályozza egyes fehérjék működését befolyásolja a sejt túlélését, a daganat érképzését, az áttétképződési folyamatot. KRASgén analízis piroszekvenálással

  37. KRASgén analízis piroszekvenálással

  38. Mutáció a KRAS génben ->folyamatosan aktív K-Ras protein -> szabályozatlan sejtosztódás -> számos rák alapja • Leggyakoribb mutációk:12., 13., 61. kodon KRASgén analízis piroszekvenálással

  39. 12. kodon KRASgén analízis piroszekvenálással

  40. 13. kodon KRASgén analízis piroszekvenálással

  41. 61. kodon KRASgén analízis piroszekvenálással