slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Supplementary Figure 1 PowerPoint Presentation
Download Presentation
Supplementary Figure 1

Loading in 2 Seconds...

play fullscreen
1 / 1

Supplementary Figure 1 - PowerPoint PPT Presentation


  • 66 Views
  • Uploaded on

a). T G C A. 43 °C 47 °C. T. b). clp P1. IR. IR. -35. -10. RBS. c). ACCTCCCTCTGACGAGGGAGGTGGCTCGACGGAGTCGAGACGGAGGGGATAGAATCCTA CGCT GGCC GCC A A AAAGCGCGTGAAAAGCC GTC TTCAGT CGCTTCAAGGCGGTAG TCTGAA CAA T GTTCGAGTAATTTAG AAGGAG AATCAAGG GTG. B. suis LMG 21814.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Supplementary Figure 1' - tuwa


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1

a)

T G C A

43°C 47 °C

T

b)

clpP1

IR

IR

-35

-10

RBS

c)

ACCTCCCTCTGACGAGGGAGGTGGCTCGACGGAGTCGAGACGGAGGGGATAGAATCCTACGCTGGCCGCCAAAAAGCGCGTGAAAAGCC

GTCTTCAGTCGCTTCAAGGCGGTAGTCTGAACAATGTTCGAGTAATTTAGAAGGAGAATCAAGGGTG

B. suis LMG 21814

B. suis LMG 21814

*

B. globosum JCM 5820

B. globosum JCM 5820

B. infantis JCM 1222

B. infantis JCM 1222

B. longum NCC2705

B. longum NCC2705

B. breve UCC 2003

B. breve UCC 2003

B. dentium JCM 1195

B. dentium JCM 1195

IR

IR

-35

*

-10

RBS

Supplementary Figure 1