tress
Uploaded by
25 SLIDES
466 VIEWS
290LIKES

Molecular Genetics

DESCRIPTION

Welcome to Lesson 1 of our 3-part unit on molecular genetics. Why should we study genetics? How is it relevant to us? I hope this Voicethread will answer these questions. Molecular Genetics. Makeup and structure of DNA Transcription (making RNA from DNA)

1 / 25

Download Presentation

Molecular Genetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Welcome to Lesson 1 of our 3-part unit on molecular genetics. • Why should we study genetics? How is it relevant to us? • I hope this Voicethreadwill answer these questions. Molecular Genetics

  2. Makeup and structure of DNA • Transcription (making RNA from DNA) • Translation (making proteins from RNA) • DNA replication (making DNA from DNA) • Crossing over What are we going to learn?

  3. To know what is happening inside our own bodies • To understand how mutations effect cell function • To understand genetic engineering • To understand the mechanism of genetic diseases • To understand biodiversity and genetic variability • So we can intelligently discuss relevant issues such as cloning and genetically modified organisms • So we can get a head start on what we need to know for college biology and eventually help cure diseases and end hunger • Can you think of more reasons...? Why do we need to know this?

  4. What do all these organisms have in common? All their genes, all their enzymes, all their proteins, all their characteristics are encoded in their DNA with four NUCLEOTIDES: A C G T

  5. Adenine = A Cytosine = C Guanine = G Thymine = T (Uracil replaces Thymine in RNA) = U NUCLEOTIDES A and T always pair up (A-T or T-A) G and C always pair up (G-C or C-G) BASE PAIRS Chargaff’s rule hinted at this pairing combination; it was eventually discovered by Watson and Crick in 1953. These are the building blocks of DNA which are in turn the building blocks of all life!!

  6. So how does DNA code for all these millions of genes with just 4 nucleotides? The same way your computer does all this cool stuff with only 0’s and 1’s (binary system) The same way we can count up to a trillion using only 10 numbers. (base 10 system) Hint: It takes A LOT of nucleotides: (4 nucleotides = base 4 system) …GGGCATTCGGAATTCCACGCGAATAATCGATCGATCGATCGATCGGGTACCAGATCGAT… There are 21 different amino acids, so how many base pairs are needed to have a unique code for each amino acid? 1 base pair = 4 unique codes (A, G, C, T) 2 base pairs = 16 unique codes (4 x 4) 3 base pairs = 64 unique codes (4 x 4 x 4)  need 3 base pairs to code for 21 amino acids (3 base pairs = 1 CODON)

  7. Yes. 64 codons but 21 (and in most organisms 20) amino acids. • 3 codons code for the “stop” sequence. That still leaves 40 left over!! • We will return to this later on in the lesson. Wait…64 codons but 21 amino acids?

  8. James Watson and Francis Crick won the Nobel prize for discovering this in 1953. Their paper, published in Nature, was less than 2 pages long. (see supplemental handout) Structure of DNA – DOUBLE HELIX

  9. Now we zoom in on the nucleotide Nitrogenous Base (Nucleoside) Deoxyribose (or ribose) Phosphate Group Structure of Nucleotide Hence the name Deoxyribonucleic acid • Structure of DNA – DOUBLE HELIX

  10. Main molecule involved: RNA Polymerase • Takes place in the nucleus • The end product: mRNA (messenger RNA) transcription of the DNA sequence • RNA polymerase reads the DNA and assembles the mRNA according to the complementary base-pair rule (A  T (or U) and C G) Transcription: DNA  RNA

  11. Before leaving the nucleus, the mRNA is “processed”. A cap and a tail are added, “introns” are cut out and “exons” are spliced back together. The details of the processing are beyond the scope of this unit, but the mRNA is essentially made ready to journey out of the nucleus and into the cytoplasm (cytosol) to carry out the next step in protein synthesis. Rna processing

  12. Main molecule involved: Ribosome • Takes place in the cytoplasm • The end product: Polypeptide (protein) • The ribosome reads the mRNA 3 base pairs at a time (1 codonat a time) and assembles the protein one amino acid (peptide) at a time according to the codons. A long chain of amino acids is thus assembled to make up a protein (polypeptide). The details of this process have been worked out to great detail but are beyond our scope at this time. One important player in this process, however, is the tRNA(transfer RNA)which carries the right amino acid to the ribosome. • Figure on next slide. Translation: rna protein (polypeptide)

  13. Notice the process is occurring in the cytoplasm. The tRNAcarry the amino acids to the ribosome. The ribosome “reads” the mRNA and incorporates the corresponding amino acid into the elongating polypeptide chain. Translation (rna Protein)

  14. In fact, we know which codons code for which amino acid. Notice there are specific codons for start (AUG) and stop. Since there are 64 possible codons and 21* amino acids, there is some redundancy in the code. The rosetta stone * Most organisms use only 20 amino acids, but a 21st amino acid has recently been discovered in extremophiles.

  15. The genetic code is commonly referred to as a “degenerate” or redundant code, meaning several codons code for the same amino acid. But it is unambiguous. What do we mean by unambiguous? What are some advantages (for the cell and for the organism) of this redundancy? Redundancy/degeneracy

  16. SUMMARY OF PROTEIN SYNTHESIS Transcription (inside the nucleus) Translation (outside the nucleus) And PROTEINS carry out the instructions encoded in DNA

  17. The following video nicely demonstrates the whole process in plenty of detail: Transcription and Translation Video Summary of transcription and translation

  18. Given what you know now about transcription and translation from this lesson and from the video, can you make and defend an argument that the terms “transcription” and “translation” are appropriate terms for the two processes? • Can you make an analogy between these two processes and transcribing or translating written text? Terminology

  19. Draw a flowchart or concept map • Draw a large picture of a cell including the nucleus • Use a process or flowsheet format to demonstrate transcription and translation. Label the steps, products, and the molecules involved. (hint: you can find pictures of this on the internet by googling “images for transcription and translation” Show me you’re learning

  20. DNA REPLICATION DNA replication occurs in much the same way as transcription, except both DNA strands are read and 2 new DNA strands (daughter strands) are made rather than one RNA strand. View the following figure for an overview of this process.

  21. DNA REPLICATION • Of course there are differences. The “lagging strand” has to be made in small pieces (Okazaki fragments) rather than continuously and then connected together by an enzyme (DNA ligase). DNA polymerase is the main character in replication rather than RNA polymerase. There are other difference which you will study in microbiology, but the essential process is similar to transcription. Here is a short video. • DNA replication video 1 • Here is another video to demonstrate this process. Do not try to memorize all the details. The big picture is that the process is IMPRESSIVE, extremely accurate, and involves many steps, but we have been able to identify the steps and the molecules involved in the process. • DNA Replication video 2

  22. How many similarities can you list between transcription and DNA replication? • How many differences can you list? Compare and contrast

  23. Do this before you proceed to the next slide: • Share your thoughts with the rest of the class • Go to Stormboard: https://stormboard.com/invite/98088/twin9722 • Use sticky notes and share 1 idea on how transcription and DNA replication are similar and 1 idea on how they are different. • Use the following ID and Key: Compare and contrast

  24. CROSSING OVER One last point about genetics that is important to our unit is the process of “crossing over” of segments of chromosomes during meiosis. The video below demonstrates this process. The importance of “crossing over” is that it contributes to genetic diversity in organisms that reproduce sexually (like mammals, reptiles, birds, fish, etc.). Another contributing factor to genetic variation is “independent assortment” of the chromosomes as we studied in the unit on cell division. This is why none of us are exactly the same as our parents or siblings. Video: Crossing over in meiosis How does this crossing over contribute to genetic variability? Why doesn’t this crossing over contribute to asexually reproducing organisms like bacteria?

  25. Final thoughts: Voicethread Your task: Complete the quiz. You may work in pairs on this quiz. Complete the vocabulary worksheet. Make a compare/contrast graphic organizer to highlight the similarities and differences between transcription and DNA replication. The quiz, vocabulary worksheet, and compare/contrast chart are downloadable from the “Lesson 1” page of the Genetics Unit website. Text: Campbell, N. (2009) Biology Concepts and Connections (6th ed.) Pearson Education: San Francisco, CA (pp 180-207)

More Related