Recovery of ZF by PCR - PowerPoint PPT Presentation

tamah
recovery of zf by pcr n.
Skip this Video
Loading SlideShow in 5 Seconds..
Recovery of ZF by PCR PowerPoint Presentation
Download Presentation
Recovery of ZF by PCR

play fullscreen
1 / 9
Download Presentation
Recovery of ZF by PCR
0 Views
Download Presentation

Recovery of ZF by PCR

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Recovery of ZF by PCR FLAG+ FLAG-

  2. RNA interference May 9

  3. siRNA • discovery • pathway DICER and RISC • software for siRNA design • databases • delivery of siRNA • testing siRNA • designing and testing siRNA against ZF

  4. suppression of ZF by siZF 10ng 100ng 500ng pcZF psiZF#14 µg 0 0.5 1 0 0.5 1 0 1 0.5 1 0.5 1 psiRad9 µg 1 2 3 4 5 6 7 8 9 10 11 14

  5. U6 prom GFP mU6pro BbsI XbaI PolIII term BspI TTTG…………TTTT …………AAAAGATC XbaI si hairpin

  6. siRNA for ZF ATGGAGGAGGAGGCGATCGCCAGCCTCCCGGGGGAAGAGACGGAGGATATGGACTTTCTGTCTGGGCTGGAACTGGCGGATCTCCTGGACCCCAGGCAACCGGACTGGCACCTGGACCCCGGGCTTAGCTCGCCGGGGCCTCTCTCCTCGTCTGGCGGAGGCTCGGATAGCGGCGGCCTGTGGAGAGGGGACGATGACGATGAGGCCGCGGCTGCTGAAATGCAGCGCTTCTCTGACCTGCTGCAAAGGCTGTTAAACGGTATCGGAGGCTGCAGCAGCAGCAGTGACAGTGGCAGCGCCGAAAAGAGGCGGAGAAAGTCCCCAGGAGGAGGCGGCGGTGGCGGCAGCGGTAACGACAACAACCAGGCGGCGACAAAGAGTCCCCGGAAGGCGGCGGCGGCCGCTGCCCGCCTTAATCGACTGAAGAAGAAGGAGTACGTGATGGGGCTGGAGAGTCGAGTCCGGGGTCTGGCAGCCGAGAACCAGGAGCTGCGGGCCGAGAATCGGGAGCTGGGCAAACGCGTACAGGCACTGCAGGAGGAGAGTCGCTACCTACGGGCAGTCTTAGCCAACGAGACTGGACTGGCTCGCTTGCTGAGCCGGCTGAGCGGCGTGGGACTGCGGCTGACCACCTCGCTCTTCAGAGACTCGCCCGCCGGTGACCACGACTACGCTCTGCCAGTGGGAAAGCAGAAGCAGGACCTGCTGGAAGAGGACGACTCGGCGGGAGGAGTCTGTCTCCATGTGGACAAGGATAAGGTGTCGGTGGAGTTCTGCTCGGCGTGCGCCCGGAAGGCGTCGTCTTCTCTTAAAATGTAG #14 #15

  7. oligos