klinefelter genetica diagnosi prenatale e comunicazione n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Klinefelter: genetica, diagnosi prenatale e comunicazione PowerPoint Presentation
Download Presentation
Klinefelter: genetica, diagnosi prenatale e comunicazione

Loading in 2 Seconds...

play fullscreen
1 / 30

Klinefelter: genetica, diagnosi prenatale e comunicazione - PowerPoint PPT Presentation


  • 205 Views
  • Uploaded on

Klinefelter: genetica, diagnosi prenatale e comunicazione. Vincenzo Nigro Laboratorio di genetica medica- Seconda Università degli Studi di Napoli Telethon Institute of Genetics and Medicine, Napoli. Cromosomi (corpi colorati).

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Klinefelter: genetica, diagnosi prenatale e comunicazione' - swain


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
klinefelter genetica diagnosi prenatale e comunicazione

Klinefelter: genetica, diagnosi prenatale e comunicazione

Vincenzo Nigro

Laboratorio di genetica medica- Seconda Università degli Studi di Napoli

Telethon Institute of Genetics and Medicine, Napoli

cromosomi corpi colorati
Cromosomi (corpi colorati)
  • durante il ciclo cellulare i cromosomi replicano e si formano due cromatidi fratelli tenuti insieme dal centromero
  • braccio corto = p (petit)
  • braccio lungo = q (lettera successiva)
46 cromosomi 2n
46 cromosomi (2n)
  • 22 coppie di autosomi
  • 2 cromosomi sessualio gonosomi o eterosomi(X,X oppure X,Y)
  • metacentrici, se il centromero è centrale
  • submetacentrici, se il centromero non è centrale e non è vicino ad un’estremità
  • acrocentrici, se il centromero è vicino ad un’estremità
xx o xy
XX oXY
  • Il sesso maschile è determinato dalla presenza del cromosoma Y
  • Si sono evoluti meccanismi per compensare la differenza di dosaggio genico del cromosoma X, presente in 2 copie nelle femmine e in 1 copia nei maschi
slide6

il cromosoma X raddoppia l’espressione di tutti i geni contenuti, cioè si produce 2 volte più RNA

  • nelle femmine uno dei due cromosomi X è inattivato casualmente in ciascuna cellula allo stadio di blastocisti

2 cromosomi X nelle donne,

1 solo negli uomini?

slide7

Nel Klinefelter (XXY) uno dei due cromosomi X è inattivato casualmente in ciascuna cellula allo stadio di blastocisti

  • Quindi il dosaggio sarebbe mantenuto

Il Klinefelter?

altre forme citogenetiche
Altre forme citogenetiche
  • Ma ci sono anche Klinefeler 48,XXYYand 48,XXXYin 1 caso su 17,000 e 1 su 50,000 mnati maschi
  • 49,XXXXY in 1 caso su 85,000 -100,000
  • Ci sono maschi 46,XX in cui avviene una traslocazione di parte di cromosoma Y sul cromosoma X che include la sex determining region (SRY)
  • mosaici
slide9
Le regioni PAR presenti sui cromosomi sessuali contengono geni che non sono inattivati, perché il doppio dosaggio è assicurato comunque

PAR1 ha 24 geni, PAR2 ha solo 4 geni

il gene shox short stature homeobox containing
Il gene SHOXShort statureHOmeoboX-containing
  • Mutazioni o delezioni del gene SHOX nella regione PAR1 causa ritardo di crescita e bassa statura.
  • La bassa statura di donne con sindrome di Turner Syndrome (X0) è il risultato di una sola copia di SHOX (ma anche il quarto metacarpo corto)
  • La maggiore statura nel Klinefelter (XXY) e nella tripla X (XXX) potrebbe essere il risultato di 3 copie di SHOX
slide11

variabilità dei geni del cromosoma X delle regioni PAR, quindi non inattivati

3 copie nel Klinefelter, ma anche nella tripla X

Mario Rossi

Luca Bianchi

Pio Verdi

Giulio Rosa

Lucio Viola

Gianni Neri

Livello di espressione

a complicare le cose
A complicare le cose…
  • circa il 15 % dei geni umani presenti sull’X sfugge all’inattivazione, mentre nel topo questa è un’evenienza rara (solo 6 geni in tutto)
  • alcuni sono espressi al 50-100% altri al 10%
  • questo fenomeno è quindi incompleto e le donne hanno una elevata eterogeneità nell’espressione di geni dell’X
slide13

ipotesi sulla variabilità di ogni singola manifestazione clinica di Klinefelter in presenza di varianti in geni del cromosoma X non inattivati

Manifestazione clinica: SI

Manifestazione clinica: NO

Mario Rossi

Luca Bianchi

Pio Verdi

Giulio Rosa

Lucio Viola

Gianni Neri

Livello di espressione

quanti klinefelter
Quanti Klinefelter?
  • Prevalenza di XXYs è cresciuta da 1.09 a 1.72 per 1000 maschi nati (P=0.023)
  • Questo incremento non è dovuto all’aumento dell’età materna
  • Sono nati 290.330 maschi in Italia e 31.573 maschi in Campania nel 2007
  • max 300-500 nuovi Klinefelter ogni anno in Italia (32-52 in Campania)
slide15
XXY è la sola trisomia nota in cui circa il 50% dei casi è causato da una non disgiunzione alla prima divisione meiotica paterna
slide16

Le alterazioni cromosomiche sono più frequenti al crescere dell’età materna, mentre le mutazioni puntiformi sono legate al numero di divisioni cellulari che avvengono circa ogni 15 gg nella linea germinale maschile

un precedente figlio con anomalie cromosomiche
Un precedente figlio con anomalie cromosomiche

Aumenta il rischio in caso di:

  • tutte le trisomie non mosaico
  • riarrangiamenti strutturali
  • marker cromosomi

Aumenta in modo non significativo il rischio in caso di:

  • 47, XXY (Klinefelter)
diagnosi prenatale di klinefelter
Diagnosi prenatale di Klinefelter
  • la consulenza genetica deve fornire con precisione tutti gli aspetti positivi e negativi senza essere direttiva, senza condizionare la decisione
  • il consulente ha il dovere di ricordare che l’aspettative di vita è normale e l’intelligenza rientra nella variabilità umana
  • i genitori hanno il diritto di prendere la loro decisione se portare avanti la gravidanza o interromperla
  • Si osserva in tutto il mondo un progressivo aumento statisticamente significativo nella percentuale di gravidanze XXY non interrotte
citogenetica di routine
da linfociti

sono rappresentativi di ciascun altra cellula del corpo

facili da ottenere

facili da stimolare in mitosi

citogenetica di routine
citogenetica prenatale
da amniociti

da villi coriali

dovrebbero essere rappresentativi delle cellule del feto

difficili da ottenere

citogenetica prenatale
mlpa test sul dna in poche ore

Maschio

Femmina

Tripla X

283 bp

346 bp

MLPA: test sul DNA in poche ore

X

variazioni genetiche

CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACCCCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTTGCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCGGCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAGGCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAAAAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTCTAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAAAGAATGTTAACAATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCTCAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAATGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCTTCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGGGGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCAGGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTGTTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCATTTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAAGGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATCCCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTGCTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTTGTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAATAAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATGTGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAACACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAATTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCTGTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAGTGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAGAAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTATAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGATCCAAAGCTCTTGCTTTGTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAGGGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGGAGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCCTGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAACTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGATCTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTCCCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACCCCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTTGCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCGGCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAGGCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAAAAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTCTAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAAAGAATGTTAACAATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCTCAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAATGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCTTCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGGGGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCAGGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTGTTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCATTTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAAGGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATCCCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTGCTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTTGTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAATAAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATGTGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAACACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAATTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCTGTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAGTGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAGAAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTATAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGATCCAAAGCTCTTGCTTTGTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAGGGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGGAGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCCTGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAACTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGATCTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC

CCCCAGCCTCCTTGCCAACGCCCCCTTTCCCTCTCCCCCTCCCGCTCGGCGCTGACCCCCCATCCCCACCCCCGTGGGAACACTGGGAGCCTGCACTCCACAGACCCTCTCCTTGCCTCTTCCCTCACCTCAGCCTCCGCTCCCCGCCCTCTTCCCGGCCCAGGGCGCCGGCCCACCCTTCCCTCCGCCGCCCCCCGGCCGCGGGGAGGACATGGCCGCGCACAGGCCGGTGGAATGGGTCCAGGCCGTGGTCAGCCGCTTCGACGAGCAGCTTCCAATAAAAACAGGACAGCAGAACACACATACCAAAGTCAGTACTGAGCACAACAAGGAATGTCTAATCAATATTTCCAAATACAAGTTTTCTTTGGTTATAAGCGGCCTCACTACTATTTTAAAGAATGTTAACTATATGAGAATATTTGGAGAAGCTGCTGAAAAAAATTTATATCTCTCTCAGTTGATTATATTGGATACACTGGAAAAATGTCTTGCTGGGCAACCAAAGGACACAATGAGATTAGATGAAACGATGCTGGTCAAACAGTTGCTGCCAGAAATCTGCCATTTTCTTCACACCTGTCGTGAAGGAAACCAGCATGCAGCTGAACTTCGGAATTCTGCCTCTGGGGTTTTATTTTCTCTCAGCTGCAACAACTTCAATGCAGTCTTTAGTCGCATTTCTACCAGGTTACAGGAATTAACTGTTTGTTCAGAAGACAATGTTGATGTTCATGATATAGAATTGTTACAGTATATCAATGTGGATTGTGCAAAATTAAAACGACTCCTGAAGGAAACAGCATTTAAATTTAAAGCCCTAAAGAAGGTTGCGCAGTTAGCAGTTATAAATAGCCTGGAAAAGGCATTTTGGAACTGGGTAGAAAATTATCCAGATGAATTTACAAAACTGTACCAGATCCCACAGACTGATATGGCTGAATGTGCAGAAAAGCTATTTGACTTGGTGGATGGTTTTGCTGAAAGCACCAAACGTAAAGCAGCAGTTTGGCCACTACAAATCATTCTCCTTATCTTGTGTCCAGAAATAATCCAGGATATATCCAAAGACGTGGTTGATGAAAACAACATGAATAAGAAGTTATTTCTGGACAGTCTACGAAAAGCTCTTGCTGGCCATGGAGGAAGTAGGCAGCTGACAGAAAGTGCTGCAATTGCCTGTGTCAAACTGTGTAAAGCAAGTACTTACATCAATTGGGAAGATAACTCTGTCATTTTCCTACTTGTTCAGTCCATGGTGGTTGATCTTAAGAACCTGCTTTTTAATCCAAGTAAGCCATTCTCAAGAGGCAGTCAGCCTGCAGATGTGGATCTAATGATTGACTGCCTTGTTTCTTGCTTTCGTATAAGCCCTCACAACAACCAACACTTTAAGATCTGCCTGGCTCAGAATTCACCTTCTACATTTCACTATGTGCTGGTAAATTCACTCCATCGAATCATCACCAATTCCGCATTGGATTGGTGGCCTAAGATTGATGCTGTGTATTGTCACTCGGTTGAACTTCGAAATATGTTTGGTGAAACACTTCATAAAGCAGTGCAAGGTTGTGGAGCACACCCAGCAATACGAATGGCACCGAGTCTTACATTTAAAGAAAAAGTAACAAGCCTTAAATTTAAAGAAAAACCTACAGACCTGGAGACAAGAAGCTATAAGTATCTTCTCTTGTCCATGGTGAAACTAATTCATGCAGCTCCAAAGCTCTTGCTTTGTAATCCAAGAAAACAGGGGCCCGAAACCCAAGGCAGTACAGCAGAATTAATTACAGGGCTCGTCCAACTGGTCCCTCAGTCACACATGCCAGAGATTGCTCAGGAAGCAATGGAGGCTCTGCTGGTTCTTCATCAGTTAGATAGCATTGATTTGTGGAATCCTGATGCTCCTGTAGAAACATTTTGGGAGATTAGCTCACAAATGCTTTTTTACATCTGCAAGAAATTAACTAGTCATCAAATGCTTAGTAGCACAGAAATTCTCAAGTGGTTGCGGGAAATATTGATCTGCAGGAATAAATTTCTTCTTAAAAATAAGCAGGCAGATAGAAGTTCCTGTCACTTTC

Variazioni genetiche
slide28

7.4 x copertura

234 runs

24.5 billions bp

slide29

11 diverse mutazioni genetiche causative identificate nel DNA di James Watson!!

Cosa avrebbe deciso di fare la mamma di Watson in seguito a questa informazione così drammatica?

una malattia
È una malattia?
  • I ragazzi con sindrome di Klinefelter non devono essere mai considerati pazienti
  • Occorre fornire tutti gli stimoli ambientali e la terapia ormonale
  • Fanno parte della sfera della variabilità umana
  • Quindi la risposta è NO