Sequence Editing Seminar: Improving DNA Identity and Data Quality

1. Today • HK • TOPOTA-colony picking/inoculation • *.ppt • NGS Illumina • GALAXY seminar • Sequence editing and BLAST data quality, improve, identity of snails

3. SNAILAND PARASITES BIOLOGY DNA “identity, possibilities” phylogenetics CTAB/DNAzol CTAB/DNAzol Illumina (full) genome sequencing gel electrophoresis nanodrop spec PCRrDNA/mito Qubit Fluorometry Covaris fragmentation Ampure (fragment collection) Kapa DNA library preparation kit Pippin size selection QC Bioanalyzer, Qubit, qPCR Illumina run TA cloning, B/W screening electrophoresis Qiagen plasmid extraction Restriction digests direct sequencing M13 sequencing Sequence ID (BLAST) editing Galaxy QC Data file (MT) genome assembly Mitos, manual annotation Gene annotation Primer design, walking Phylogenetics GenBank submission

4. 1) Do 15+ minutes • Add 6 ml Use HALF vial of One Shots 2) Do 15 minutes ice 7) Spread 10 on one plate and100 on another

5. BECAUSE OF TEMPLATE INDEPENDENT 3’ A-ADDITION TO AMPLICON MORE EFFICIENT THAN LIGASE

6. PlasmidDesign BioTech No ligase

7. Cloning Insert amplicon (circularize plasmid) Transform bacteria(no previous antibiotic resistance, galactosidase activity) Selection for presence of Plasmid and Insert

8. Alpha complementation, BLUE/WHITE screening One-shot E. coli have a non functional mutantlacZ gene with deleted sequence (i.e. lacZΔM15) MCS The plasmid EncodesLacZ (alphapeptide) IF not interrupted by an insert (alpha peptide)

9. Growth on selective media (Kanamycin 100mg/ml) Metabolize X-gal (carbohydrate -> blue) LacZ LacZ-a antibiotics resistance insert (!) R

10. Metabolize X-gal to screen for insert (carbohydrate -> blue) Growth on selective media (Kanamycin 100mg/ml) NO YES YES LacZ-a antibiotics resistance insert (!) R

11. Metabolize X-gal to screen for insert (carbohydrate -> blue) Growth on selective media (Kanamycin 100mg/ml) NO (-) YES YES NO YES LacZ LacZ-a antibiotics resistance insert (!) R

12. Metabolize X-gal to screen for insert (carbohydrate -> blue) Growth on selective media (Kanamycin 100mg/ml) NO (-) YES YES NO YES LacZ LacZ-a antibiotics resistance insert (!) R

13. 1) Do 10 minutes 7) Spread 10 on one plate and100 on another

14. Friday Each group Select 4 white colonies, sample by “scraping” with yellow tip Eject yellow tip with bacteria in 2.5 ml LB, 100mg/ml kanamycin 4x4 colonies EP1_18S, 3x12 colonies EP1_28S, 3x4 colonies EP3_18S 1,3,5,6 4,8,10 2,7,9SHARE COLONIES IF NEEDED OR….? NO colonies, troubleshoot, repeat!

15. *.ppt

16. S4 PES4 S4: Physid snail Echinostomid cercariae Total DNA minus RNA Illumina whole genome sequencing Qubit Fluorometry Covaris fragmentation Ampure (fragment collection) Kapa DNA library preparation kit Pippin size selection QC Bioanalyzer, Qubit, qPCR Illumina run NextSeq Illumina genome sequencing NEEDs 500-1000 ng DNA for Kapa Hyper prep kit https://www.kapabiosystems.com/assets/KAPA_Hyper_Prep_Kit_TDS.pdf

17. NextSeq Illumina run, 130 million, 2 x 150 (300nt) Paired End Reads Result: ≤ 3,900,000,000 nucleotides(inspect all nts @1/sec: 365/24/60/60 = ~123 years) Sequence quality: Trimming bad sequence + Filtering to remove adaptors, barcodes Assembly https://www.youtube.com/watch?annotation_id=annotation_1533942809&feature=iv&src_vid=HMyCqWhwB8E&v=fCd6B5HRaZ8

18. Bring your LAPTOP Use W7 LAPTOP URL: http://emil.unm.edu/galaxy Login: UNM account id without @unm. pw:4546L2018 September 24th, Dr LiJing Bu

19. DNA SANGER SEQUENCING “*.ABI” Sequence analysis?

20. Forward primer sequencing reaction sequencing generates + strand ATCG ggaa 5’ 3’ dye blobs Reverse primer sequencing reaction CCTT tagc 5’ generates - strand 3’ dye blobs

22. sequencing + strand sense coding primerR A 5’ primerF 3’ A - strand antisense non-coding primerR 3’ primerF 5’ sense GGAA A 5’ ATCG 3’ NEED TO KNOW WHY SEQUENCE THIS? A antisense CCTT 3’ TACG 5’

23. sequencing forward + strand sense coding primerR A 5’ primerF 3’ A - strand antisense non-coding primerR 3’ primerF 5’ sense GGAA A 5’ ATCG 3’ Forward primer sequencing reaction ATCG 5’ 3’ A - strand antisense non-coding CCTT 3’ TACG 5’

24. sequencing results + strand sense coding primerR A 5’ primerF 3’ A - strand antisense non-coding primerR 3’ primerF 5’ Forward primer sequencing reaction generates sense strand ATCG ggaa 5’ 3’ A - strand antisense non-coding CCTT 3’ TACG 5’

25. sequencing reverse + strand sense coding primerR A 5’ primerF 3’ A - strand antisense non-coding primerR 3’ primerF 5’ sense GGAA A 5’ ATCG 3’ A antisense CCTT 3’ TACG 5’

26. sequencing reverse + STRAND SENSE CODING GGAA A 5’ ATCG 3’ A - strand antisense non-coding cctt 3’ tagc 5’ Reverse primer sequencing reaction SENSE GGAA A 5’ ATCG 3’ CCTT 5’ 3’ A antisense CCTT 3’ TACG 5’

27. sequencing results + STRAND SENSE CODING GGAA A 5’ ATCG 3’ A - strand antisense non-coding cctt 3’ tagc 5’ Reverse primer sequencing reaction SENSE GGAA A 5’ ATCG 3’ CCTT tagc 5’ generates - strand 3’

28. sequencing results + STRAND SENSE CODING GGAA A 5’ ATCG 3’ A - strand antisense non-coding cctt 3’ tagc 5’ Reverse primer sequencing reaction SENSE GGAA A 5’ ATCG 3’ CCTT tagc 5’ generates - strand 3’ ABI File generated 5’-3’ Sequence is reverse complement of coding sequence !

29. Forward primer sequencing reaction sequencing generates + strand ATCG ggaa 5’ 3’ Reverse primer sequencing reaction CCTT tagc 5’ generates - strand 3’ sequencing generates + strand ATCG ggaa 5’ 3’ reverse complement yields + (coding) sequence two confirmatory sets of sequence data

30. sequencing results + STRAND SENSE CODING GGAA A 5’ ATCG 3’ A - strand antisense non-coding cctt 3’ tagc 5’ Reverse primer sequencing reaction SENSE GGAA A 5’ ATCG 3’ CCTT tagc 5’ generates - strand 3’ ABI File generated 5’-3’ TTCC cgat 3’ 5’ dnarts - setareneg Sequence is reverse complement of coding sequence !

31. Sequence editing (H8) Full length of amplicon? Look for other primer Do we have all information? Edit, compare replicate reactions Compare computationally to other sequences BLAST AND Phylogenetic analysis for “best” identification

32. So full length? Abrupt end Primer? Same for other sequencing reaction

33. ? LCO1490: 5'-GGT CAA CAA ATC ATA AAG ATA TTG G -3’ HC02198: 5'-TAA ACT TCA GGG TGA CCA AAA AAT CA-3’ Primer is reverse complement at end of sequence run

34. Sequence reverse complemented LCO1490: 5'-GGT CAA CAA ATC ATA AAG ATA TTG G -3’ HC02198: 5'-TAA ACT TCA GGG TGA CCA AAA AAT CA-3’ Primer is reverse complement at end of seqeunce run

35. Sequence reverse complemented LCO1490: 5'-GGT CAA CAA ATC ATA AAG ATA TTG G -3’ HC02198: 5'-TAA ACT TCA GGG TGA CCA AAA AAT CA-3’ Primer is reverse complement at end of sequence run

36. Fix “N” calls: what are these? Stay at regular spacing distance

37. Fix “N” calls: what are these? Stay at regular spacing distance

38. Dye Blobs? Edit under the blob

39. A G C G T N A A NNNN Dye Blobs? Edit under the blob

40. A G C G T N A A NNNN T T G A C G A G C A T T T T T A Dye Blobs? Edit under the blob

41. BLAST

42. BLAST

43. Pseudosuccinea columella mitochondrial COI gene for cytochrome oxidase subunit I, partial cds, isolate: Pc.2 Sequence ID: gi|972806524|LC015521.1Length: 667Number of Matches: 2 Related Information Range 1: 132 to 656GenBankGraphics Next Match Previous Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 569 bits(630) 2e-158 432/525(82%) 0/525(0%) Plus/Plus Query 126 TTTTGTTATAAtttttttCATANTTATACCAATAATANTTGGAGGGTNNGGAAATTGAAT 185 |||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||||| Sbjct 132 TTTTGTTATAATTTTTTTCATAGTTATACCAATAATAATTGGAGGGTTTGGAAATTGAAT 191 Query 186 AGTTCCNCTTCTCATTGGNGCTCCNNATATAANATTTCCTCGNATAAATAATATANNANN 245 |||||| ||||||||||| ||||| |||||| ||||||||| |||||||||||| | Sbjct 192 AGTTCCACTTCTCATTGGTGCTCCAGATATAAGATTTCCTCGTATAAATAATATAAGATT 251 Query 246 TTGATTACTACCACCTTCNNTTATTCTCTTACTTTGNTCTNGAATANNANAAGGTGGGGN 305 |||||||||||||||||| |||||||||||||||| ||| ||||| | ||||||||| Sbjct 252 TTGATTACTACCACCTTCGTTTATTCTCTTACTTTGCTCTAGAATAGTAGAAGGTGGGGT 311 Query 306 AGGNACTGGATGAACAGTTTACCCACCATTGANTGGACCTATTGCTCATGGNGGATCTTC 365 ||| |||||||||||||||||||||||||||| |||||||||||||||||| |||||||| Sbjct 312 AGGTACTGGATGAACAGTTTACCCACCATTGAGTGGACCTATTGCTCATGGTGGATCTTC 371 Query 366 TGNNGANNNNNCTATNNTNTCNNTNCNTNTANCCGGNTNATNNNNGATTTTAGGANNNNN 425 || || |||| | || | | | || |||| | || |||||||||| Sbjct 372 TGTTGATTTAGCTATTTTTTCTTTACATTTAGCCGGTTTATCCAGGATTTTAGGAGCAAT 431 Query 426 NNATTTTATTACTACnntttttAATATACNATCTCCNGGNATTACATTANANCNAANAAN 485 ||||||||||||| |||||||||||| |||||| || ||||||||| | | || || Sbjct 432 TAATTTTATTACTACAATTTTTAATATACGATCTCCAGGTATTACATTAGAACGAATAAG 491 Query 486 ATNATTTGTATGATCNGNATTAGTTACNGCTTNTNNNCTTCTTTTATCTNTNCNNNTACT 545 || |||||||||||| | ||||||||| |||| | |||||||||||| | | |||| Sbjct 492 ATTATTTGTATGATCTGTATTAGTTACAGCTTTTTTACTTCTTTTATCTTTACCAGTACT 551 Query 546 TGCAGGGGCAATTACNANGNTTTTNACANATCGAAATTTTNNTACNACTTNTTTTGATCC 605 ||||||||||||||| | | |||| ||| ||||||||||| ||| |||| ||||||||| Sbjct 552 TGCAGGGGCAATTACAATGCTTTTAACAGATCGAAATTTTAATACCACTTTTTTTGATCC 611 Query 606 TGCTGGAGGTGGNGATNNNATTTTATATCAACNTNNATTCTGATT 650 |||||||||||| ||| ||||||||||||| | ||||||||| Sbjct 612 TGCTGGAGGTGGTGATCCTATTTTATATCAACATTTATTCTGATT 656 Similar but not same Need to do phylogenetics.