400 likes | 596 Views
Today. G Protein Coupled Receptors. Animals. plasma membrane. signal transduction pathway, i.e.; cAMP phospholipase C cGMP phosphodiesterase MAPK. activated receptor. cycles. something else happens. something happens. Mammals. ~ 4 Orthologs > 23 Paralogs.
E N D
G Protein Coupled Receptors Animals
plasma membrane • signal transduction pathway, i.e.; • cAMP • phospholipase C • cGMP phosphodiesterase • MAPK activated receptor cycles something else happens something happens
Mammals ~ 4 Orthologs > 23 Paralogs
Why Arabidopsis?Why me? Only one prototypical Ga protein.
Why Ga?Why did my collaborators care? Looking for the Auxin Receptor, • auxin is a plant hormone implicated in multiple physiological pathways.
G Protein Coupled Receptors Auxin Functions gravitropism/thigmatropism, etc. perception of light general signal transduction embryogenesis development cell growth and differentiation “oncogenesis” etc.
Auxin Receptor = G Protein Coupled Receptor? Maybe Reverse Genetics can supply an answer?
Homologous Recombination Range • Yes... • mice, many well characterized mammalian cells, • bacteria, • yeast, (remember the bar code deletion project), • No (maybe)... • C. elegans (no), • Arabidopsis (done once, not repeated), • Drosophila (shown in principle, not repeated often), • the rest?
T-DNA Ti-Plasmid Plant Cells Lab Selectable Markers Reporter Genes Genes Nature Hormone genes Opines genes Agrobacterium T-DNA Out: Ti genes, opine genes, In: DNA of choice.
from ~500,000 seeds
60,000 mutants Set-UpDNA Pooling Maintain lines as pools of seed. Seeds (9) Germinate and grow seeds in liquid culture. Seedlings (225) Extract DNA, DNA (225) Super Pool DNA, Super Pools (2000) 1 2 3 4 5 6 …30 PCR Screen
T-DNA Reaction: T-DNA Reaction: Product: Product: PCR Strategy
T-DNA Insertion Confirmation G wt • Blot gel and hybridize with a WT probe. • Band isolate and cycle sequence PCR fragment.
T-DNA Reaction: Product: Sequence T-DNA Insertion Sites Sequence using the PCR primer from the T-DNA sequence. T-DNA Unknown GTP GPA1: \\GCAATGTGTTATTAAGTTGTCT --- ATGCTCTC--- GAAAATTTTCGCCACTGGAAAT// GPA2: \\TGTCTAAGCGTCAATTTGTTTA --- GGGCTCTCTCT--- ACCTGCTCAGGAGCACCTTTAC//
p = probability of insertion event f = 1-(Genome/Size of Gene) n = number of T-DNA inserts Probability of Finding an Insert in a Specific Gene p = 1-(1-f)n thousands of inserts
Finding Random Insertion Mutants • Use PCR based approach to identify sequence with foreign DNA inserted into genes of interest.
GTP binding sites. Effector domains. Receptor interaction domain. Gbg sub-units binding site. KO
~ 11 Kb Probe SpeI SpeI SpeI wt gpa1 het gpa1 hom gpa2 het gpa2 hom …not drawn to scale. Genotype? Southern Analysis Genomic DNA, Cut with SpeI, Probe with 3’ GPA. ~ 5 Kb
wt truncated Transcript? Northern Analysis Extract total RNA Use complementary DNA to probe for mRNA
Protein? Western Analysis Proteins extracted Antibodies specific to GPA proteins facilitate probing for the presence of the protein. Antibody was raised to the N-terminus of the gene.
T-DNA Mutants Genetic Analysis TT Tt Tt tt T t 2x T-DNA Segregation T t F2 tagged seed line tt x TT (wt) isolate homozygous mutant Tt (R / D) backcross to wildtype phenotype analysis
TT TT TT Tt Tt Tt T T t t T t Tt Tt Tt tt tt tt T T T t t t 1 : 2 : 1 1 wt : 2 het 1 wt : 1 het Not Lethal Lethal Gametophyte Lethal Genetic AnalysisF2 Segregation
Arabidopsis Gantlet Project http://thale.biol.wwu.edu/ Questions Name? Quest? Air-speed velocity of an unladen swallow? How do you spell Guantlet?
Mitosis? cyc1At-CDB-GUS
Overexpression? • Transgene: • GPA1 driven by an inducible promoter, • - dexamethason, • In “WT” plants.
GPA1 function?BY-2 Cells • …over-express GPA1 in cell culture lines, • - measure G1 to G2 transitions, • - measure cell plate formations.
Conclusions GPA1 operates in controlling cell proliferation, probably by modulating G1 control. May be involved in auxin signal reception?
something happens KO Turns out agb1 (b-sub-unit) phenotype identical to gpa1, …what do you think that means? MAPK?
GPA1, What Else II?Brassinolide Plant Physiol, June 2002, Vol. 129, pp. 897-907 Since 2001
Mammals > 4 Orthologs > 23 Paralogs