Understanding the Central Dogma of Molecular Biology: From Genes to Proteins
160 likes | 318 Views
This lecture explores the fundamental concepts of the central dogma of molecular biology, focusing on how the human genome, containing approximately 24,000 genes, encodes over 100,000 proteins through processes like transcription and translation. Key topics include the differentiation between haploid and diploid cells, the roles of exons and introns in RNA splicing, and the flow of genetic information. Dive into DNA's role as a template, the process of gene expression, and the significance of proteins in cellular functions.
Understanding the Central Dogma of Molecular Biology: From Genes to Proteins
E N D
Presentation Transcript
Lecture Objectives • Define Terms: • Transcription, Translation, nucleic acid, amino acid, DNA, RNA, mRNA, cDNA, “ATCG”, Gene, Genomics, Protein, Proteomics, Exon, Intron, Chromosome, Nucleus, Ribosome, Diploid, Codon, UTR. • Explain Concepts: • How 24,000 genes in the human genome encode more than 100,000 proteins. • How information flows through Transcription and Translation. • 4 points of information control in the cell. • Explain RNA splicing with respect to Exons and Introns. • Explain the difference between a Haploid and a Diploid Cell.
CAGGACCATGGAACTCAGCGTCCTCCTCTTCCTTGCACTCCTCACAGGACTCTTGCTACTCCTGGTTCAGCGCCACCCTAACACCCATGACCGCCTCCCACCAGGGCCCCGCCCTCTGCCCCTTTTGGGAAACCTTCTGCAGATGGATAGAAGAGGCCTACTCAAATCCTTTCTGAGGTTCCGAGAGAAATATGGGGACGTCTTCACGGTACACCTGGGACCGAGGCCCGTGGTCATGCTGTGTGGAGTAGAGGCCATACGGGAGGCCCTTGTGGACAAGGCTGAGGCCTTCTCTGGCCGGGGAAAAATCGCCATGGTCGACCCATTCTTCCGGGGATATGGTGTGATCTTTGCCAATGGAAACCGCTGGAAGGTGCTTCGGCGATTCTCTGTGACCACTATGAGGGACTTCGGGATGGGAAAGCGGAGTGTGGAGGAGCGGATTCAGGAGGAGGCTCAGTGTCTGATAGAGGAGCTTCGGAAATCCAAGGGGGCCCTCATGGACCCCACCTTCCTCTTCCAGTCCATTACCGCCAACATCATCTGCTCCATCGTCTTTGGAAAACGATTCCACTACCAAGATCAAGAGTTCCTGAAGATGCTGAACTTGTTCTACCAGACTTTTTCACTCATCAGCTCTGTATTCGGCCAGCTGTTTGAGCTCTTCTCTGGCTTCTTGAAATACTTTCCTGGGGCACACAGGCAAGTTTACAAAAACCTGCAGGAAATCAATGCTTACATTGGCCACAGTGTGGAGAAGCACCGTGAAACCCTGGACCCCAGCGCCCCCAAGGACCTCATCGACACCTACCTGCTCCACATGGAAAAAGAGAAATCCAACGCACACAGTGAATTCAGCCACCAGAACCTCAACCTCAACACGCTCTCGCTCTTCTTTGCTGGCACTGAGACCACCAGCACCACTCTCCGCTACGGCTTCCTGCTCATGCTCAAATACCCTCATGTTGCAGAGAGAGTCTACAGGGAGATTGAACAGGTGATTGGCCCACATCGCCCTCCAGAGCTTCATGACCGAGCCAAAATGCCATACACAGAGGCAGTCATCTATGAGATTCAGAGATTTTCCGACCTTCTCCCCATGGGTGTGCCCCACATTGTCACCCAACACACCAGCTTCCGAGGGTACATCATCCCCAAGGACACAGAAGTATTTCTCATCCTGAGCACTGCTCTCCATGACCCACACTACAGGACCATGGAACTCAGCGTCCTCCTCTTCCTTGCACTCCTCACAGGACTCTTGCTACTCCTGGTTCAGCGCCACCCTAACACCCATGACCGCCTCCCACCAGGGCCCCGCCCTCTGCCCCTTTTGGGAAACCTTCTGCAGATGGATAGAAGAGGCCTACTCAAATCCTTTCTGAGGTTCCGAGAGAAATATGGGGACGTCTTCACGGTACACCTGGGACCGAGGCCCGTGGTCATGCTGTGTGGAGTAGAGGCCATACGGGAGGCCCTTGTGGACAAGGCTGAGGCCTTCTCTGGCCGGGGAAAAATCGCCATGGTCGACCCATTCTTCCGGGGATATGGTGTGATCTTTGCCAATGGAAACCGCTGGAAGGTGCTTCGGCGATTCTCTGTGACCACTATGAGGGACTTCGGGATGGGAAAGCGGAGTGTGGAGGAGCGGATTCAGGAGGAGGCTCAGTGTCTGATAGAGGAGCTTCGGAAATCCAAGGGGGCCCTCATGGACCCCACCTTCCTCTTCCAGTCCATTACCGCCAACATCATCTGCTCCATCGTCTTTGGAAAACGATTCCACTACCAAGATCAAGAGTTCCTGAAGATGCTGAACTTGTTCTACCAGACTTTTTCACTCATCAGCTCTGTATTCGGCCAGCTGTTTGAGCTCTTCTCTGGCTTCTTGAAATACTTTCCTGGGGCACACAGGCAAGTTTACAAAAACCTGCAGGAAATCAATGCTTACATTGGCCACAGTGTGGAGAAGCACCGTGAAACCCTGGACCCCAGCGCCCCCAAGGACCTCATCGACACCTACCTGCTCCACATGGAAAAAGAGAAATCCAACGCACACAGTGAATTCAGCCACCAGAACCTCAACCTCAACACGCTCTCGCTCTTCTTTGCTGGCACTGAGACCACCAGCACCACTCTCCGCTACGGCTTCCTGCTCATGCTCAAATACCCTCATGTTGCAGAGAGAGTCTACAGGGAGATTGAACAGGTGATTGGCCCACATCGCCCTCCAGAGCTTCATGACCGAGCCAAAATGCCATACACAGAGGCAGTCATCTATGAGATTCAGAGATTTTCCGACCTTCTCCCCATGGGTGTGCCCCACATTGTCACCCAACACACCAGCTTCCGAGGGTACATCATCCCCAAGGACACAGAAGTATTTCTCATCCTGAGCACTGCTCTCCATGACCCACACTA
Central Dogma of Molecular Biology: DNA acts as a template to replicate itself DNA is also TRANSCRIBED into RNA RNA is TRANSLATED into Protein
Human Genome: Diploid (2 copies of genetic material) 46 Chromosomes (total) Gender-specific Chromosomes: XX = Female XY = Male Not all cells/organisms are diploid gametes = haploid (1 copy) wheat, corn = hexaploid (6 copies) “Chromosome” literally means “color” And “body” described by early microscopists referring to the subcellular structures that stained by some dyes.
Human Genome: 1st Sequenced (Published) in February 2001 Over 3 Billion base pairs Estimated 35,000 genes (20% have been patented!). Genes defined as regions of the genome that encode RNA that are translated into proteins. Estimated >100,000 proteins from 35,000 genes (only 1.5% of the genome are “genes”) Each gene can encode multiple proteins due to “alternative splicing”.
DNA hnRNA mRNA Protein Transcription RNA Splicing Translation
Promoter region Steps in Transcription: 1) Double-stranded DNA (gene) is separated into single strands. 2) RNA Polymerases make exact RNA template from DNA (hnRNA). 3) Introns are spliced out of hnRNA to make mRNA. 4) Poly-A tail is added to 3’ end of mRNA. 5) mRNA moves out of nucleus to ribosome (in the cytosol) where protein translation occurs (protein from mRNA template). “poly-A tail” UnTranslated Regions (UTR) 3’ UTR before translation start site 5’ UTR after translation stop site 100-300 “A”
Protein – “The structural, functional and secreted stuff” “The stuff you are made of” “skin, hair, cartilage, tendons, eye color, etc.” “where genetic information is translated into function” Made up of 20 different amino acids that each harbor different molecular characteristics (soluble, insoluble, acidic, basic, etc, etc). Protein Dogma: Sequence of amino acids confers specific 3D characteristics 3D characteristics correlates with function
Protein TRANSLATION from mRNA The genetic “bit” information to encode a specific amino acid is contained in a gene’s Codon. A Codon is a 3-base (3-nucleotide) sub-sequence that defines the amino acid to be incorporated into the protein. All proteins start with the Codon ATG (DNA notation) or AUG (RNA), which encodes for the amino acid Methionine. This start or “initiation” codon sets the “Reading Frame” for Translation. Many genetic mutations involve the deletion of a single nucleotide, which causes a “Frame Shift” (aka Frame Shift Mutation), disrupting the Translational process causing a change in the amino acid composition and alters the stop codon for all amino acids “Down stream” from this type of mutation.
THEREDCATWASNOTHOTBUTWASWETANDMADYETSADBUTTHEFOXGOTWETANDATEHIMTHEREDCATWASNOTHOTBUTWASWETANDMADYETSADBUTTHEFOXGOTWETANDATEHIM THEREDCAT_HSDKLSD_WASNOTHOTBUT_WKKNASDNKSAOJ.ASDNALKS_WASWET_ASDFLKSDOFIJEIJKNAWDFN_ANDMAD_WERN.JSNDFJN_YETSAD_MNSFDGPOIJD_BUTTHEFOX_SDKMFIDSJIR.JER_GOTWET_JSN.DFOIAMNJNER_ANDATEHIM.
Add a 2 x 4 lego block… Start with a thin 2 x 4 lego block… Add a 2 x 2 lego block… Add a 2 x 3 lego block…
4 points of molecular information control 1) Transcriptional Control Control of which genes are “used” or “expressed” by the cell. 2) RNA Processing or Splicing Editing out of introns and sometimes key exons. 3) Translational Control Control of the amount of protein made from mRNA. 4) Protein Activity Control Control of how a protein’s activity.