'Starting time' presentation slideshows

Topic 36

Topic 36. Reservation Systems without Slack. Overview of Service Industry Models. (Lot sizing) Reservation systems Timetabling Workforce scheduling. Reservation without Slack. Reservation system with m machines, n jobs Release date r j , due date d j , weight w j No slack

1.13k views • 87 slides

Oregon Health and Air Quality HYSPLIT, CALIPSO, and Air Quality Tutorial

Oregon Health and Air Quality HYSPLIT, CALIPSO, and Air Quality Tutorial. NASA DEVELOP Spring 2013 Stephen Quinn (Team Lead) Zachary Toll (Team Lead) Brittany Parsons Amanda Gray Carrea Dye Marlene Lichty. Table of Contents. HYSPLIT CALIPSO Google Earth Imagery

1.04k views • 75 slides

EcE 5013 Digital Signal Processing

EcE 5013 Digital Signal Processing. Daw Mya Mya Aye Deputy Professor Department of Electronic Engineering & Information Technology Yangon Technological University. Overview. Continuous or analog signals Discrete-time signals Basic analog signals Basic discrete signals Quantized signals

1.13k views • 58 slides

Optimal Rail Track Allocation

796 views • 57 slides

Topic 36

Topic 36. Reservation Systems without Slack. Overview of Service Industry Models. Reservation systems Timetabling Workforce scheduling. Reservation without Slack. Reservation system with m machines, n jobs Release date r j , due date d j , weight w j No slack

702 views • 54 slides

Standards

Standards. IS 13947 IEC 60947. Below or Equal to 1000V for AC & 1200V for DC. LOW VOLTAGE. SWITCHGEAR. SWITCHING. PROTECTION. N. Y. CONTACTOR. N. Y. RELAY. Y. Y. STARTER. SWITCH / SD. Y. N. HRC FUSE. N. Y. SFU/FSU/SDF. Y. Y. ACB. Y. Y. MCCB. Y. Y. MPCB. Y.

935 views • 49 slides

Project Planning

Project Planning. Management Processes. Planning Organizing Actuating Controlling. Planning Cycle. OK. Evaluation. Planning. Actuating. Feedback. Benefit of Planning. Reduce Uncertainty Key to success Increase effectiveness and efficiency Starting point for controlling.

717 views • 46 slides

Translation

Translation. 1. Summarize each of the 6 steps of transcription. 2. Make an mRNA copy from the DNA gene : GCATATGCAATGATAGATTGA CGTATACGTTACTATCTAACT 3. How did you know whether the gene was on the top or bottom strand?. Bellwork. Grade hmw .

567 views • 43 slides

A Decision Support System for Improving Railway Line Capacity

A Decision Support System for Improving Railway Line Capacity. G Raghuram VV Rao Indian Institute of Management, Ahmedabad. Planning Model Not on line Objective: Maximize line capacity Operational Model On line Objective: Minimize train detentions. Planning Model. Math Programming

330 views • 32 slides

A Decision Support System for Improving Railway Line Capacity

A Decision Support System for Improving Railway Line Capacity. G Raghuram VV Rao Indian Institute of Management, Ahmedabad. Planning Model Not on line Objective: Maximize line capacity Operational Model On line Objective: Minimize train detentions. Planning Model. Math Programming

400 views • 32 slides

Insertion of Random Tasks in a schedule

Insertion of Random Tasks in a schedule. 2005. 2. 19 MAI Lab. ???. Papers. Insertion of a random task in a schedule: a real-time approach - Cyril Duron et. al. (2005) Insertion techniques for the heuristic solution of the job shop problem Frank Werner et. al. (1995).

384 views • 25 slides

How to make Parent Bookings

311 views • 24 slides

Lecture 18

Lecture 18. CSE 331 Oct 12, 2012. HW 5 due today. Q1, Q2 and Q3 in different piles. I will not take any HW after 1:15pm. Other HW related stuff. Graded HW4 starting Monday. Solutions to HW 5 at the end of the lecture. On Thursday, Oct 18. hours-a-thon. Unclaimed HWs and solutions.

302 views • 20 slides

618 views • 19 slides

Elapsed Time

Elapsed Time. Objectives: I can tell time on an analog clock and represent the time in writing. I can use a number line to represent the hours and minutes of a clock, and use it to solve elapsed time problems. Review.

521 views • 9 slides

Editorial

Mercedes C and Chase M. Editorial. Chases opinion on Louisville basketball. Basketball officiating at the University of

233 views • 7 slides

Dynamic Light Scattering

Dynamic Light Scattering. Christine Fernyhough. Why use DLS?. Information on SIZE SIZE DISTRIBUTION SHAPE? CHARGE? of particles in solution Micelles, vesicles, latexes..... unimolecular species? Requires powerful laser!. Experimental set up.

726 views • 7 slides

Fourth of July Celebration

Fourth of July Celebration. In-Line Skate Race in the Park. Registration is at 7:00 am on July 4th Starting time is 8:15 am Early registration forms must be postmarked no later than June 29th. In-Line Skate Race Rules. All racers must be wearing the following: Helmet Wrist guards

155 views • 5 slides

ESRM HUNT THE GLEBE HUNTER TRIALS Sunday 12 th October 2014

ESRM HUNT THE GLEBE HUNTER TRIALS Sunday 12 th October 2014. RULES AND CONDITIONS All competitors and owners of horses and ponies take part at their own risk.

189 views • 5 slides

Show Order

142 views • 4 slides