'Secret message' presentation slideshows

NUMBER THEORY

NUMBER THEORY. Chapter 5: Cryptology. Era of Electronic. Electronic communication Electronic Banking. Terminology. Cryptology: Discipline Cryptography: Design & Implementation Cryptoanalysis : Breaking the system. Terminology. Plaintext: secret message

960 views • 76 slides

Translation

Translation. 1. Summarize each of the 6 steps of transcription. 2. Make an mRNA copy from the DNA gene : GCATATGCAATGATAGATTGA CGTATACGTTACTATCTAACT 3. How did you know whether the gene was on the top or bottom strand?. Bellwork. Grade hmw .

566 views • 43 slides

Network Security: Email Security, PKI

Network Security: Email Security, PKI. Tuomas Aura T-110.5240 Network security Aalto University, Nov-Dec 2011. Outline. Email security Pretty Good Privacy (PGP) Certificates PGP web of trust X.509 public-key infrastructure (PKI)

594 views • 37 slides

Attribute Aggregation in Federated Identity

Attribute Aggregation in Federated Identity. Attribute Aggregation in Federated Identity. Nate Klingenstein ndk@internet2.edu. ToC. The Problem The Framework The Solutions The New Problems. The Problem (carmody@IEEE).

352 views • 25 slides

Public Key Model

547 views • 24 slides

Classroom Management

364 views • 22 slides

Dan DeBlasio and Brad Mundt University of Central Florida

An Enhanced Steganographic Method for Data Hiding in Microsoft Word Documents by a Change Tracking Technique. Dan DeBlasio and Brad Mundt University of Central Florida deblasio@cs.ucf.edu, bmundt@pegasus.cc.ucf.edu. Steganography. What is Steg?

302 views • 22 slides

CRYPTOGRAPHY

Greece was organized into small, disunited, independent city-states. ... The apparently blank tablets got to Greece, where they realized (how? ...

470 views • 21 slides

Simple and Unbreakable: The Mathematics of Internet Security

Simple and Unbreakable: The Mathematics of Internet Security. Dr. Monica Nevins Department of Mathematics and Statistics University of Ottawa. University of Ottawa Day, 2007. Cryptography ca. 50 BC. Example: VENI, VIDI, VICI Becomes: YHQL, YLGL, YLFL.

336 views • 21 slides

Cryptography Basics

Cryptography Basics. Henry Wise Wood Math and Computer Science Club December 12, 2011. Why do I need Cryptography?. Confidentiality Ensuring that only intended recipients can read a message

291 views • 19 slides

World War I Chapter 6 Section 1 Part B

405 views • 16 slides

The Invention of Hugo Cabret

1.06k views • 15 slides

Encoding and Decoding

Encoding and Decoding. Your Mission. The following slides contain encoded sentences. Decode the sentences. Describe the set of rules or pattern that encoded the sentence. 25-15-21 19-15-12-22-5- 4 20 -8-5 6-9-18-19- 20 15 -14-5. Encoded Sentence:. YOU SOLVED THE FIRST ONE.

410 views • 15 slides

Encoding and Decoding

Encoding and Decoding. Your Mission. The following slides contain encoded sentences. Decode the sentences. Describe the set of rules or pattern that encoded the sentence. 25-15-21 19-15-12-22-5- 4 20 -8-5 6-9-18-19- 20 15 -14-5. Encoded Sentence:. (Use this space to work it out).

1.11k views • 15 slides

Translation

302 views • 13 slides

Hybrid Hiding Encryption Algorithm (HHEA)

Hybrid Hiding Encryption Algorithm (HHEA). K.V.Bhargavi 2001HS12557. Outline. Basic Idea Encryption Process Algorithm Decryption Process Key Length Algorithm Analysis Conclusion. Basic operations include inserting part of the plain text bits into a cover to hide it from recognition.

230 views • 13 slides

SAT Vocabulary Lesson #8

SAT Vocabulary Lesson #8. Cryptic-(adj.)secret, having secret message. Cursory-(adj.)without attention to details. Dearth-(adj.)shortage. Debilitate-(v.)to weaken. Decadence-(n.)decay , decline. Deference-(n.) great respect. Deflate-(v.)to let the air out of, reduce in size.

209 views • 11 slides

Watermarking and Steganography

Watermarking and Steganography. Watermarking is the practice of hiding a message about an image, audio clip, video clip, or other work of media within that work itself.

383 views • 10 slides

STEGANOGRAPHY Sonya Febiatiningsih (11103849)

STEGANOGRAPHY Sonya Febiatiningsih (11103849). for further detail, please visit http://library.gunadarma.ac.id. Abstrak.

217 views • 7 slides

Do Now

Do Now. Decipher these messages below in your do now section of your binder: 1.) LOL, 2.) OMG, 3.) TTYL, 4.) IDK, 5.) BTW Where might you see the types of messages that appear on the board/overhead? What makes this type of communication different from the normal written word?.

160 views • 5 slides