100+ Ne5ms2ls PowerPoint (PPT) Presentations, Ne5ms2ls PPTs

Ne5ms2ls - PowerPoint PPT Presentation

Translation

Translation. 1. Summarize each of the 6 steps of transcription. 2. Make an mRNA copy from the DNA gene : GCATATGCAATGATAGATTGA CGTATACGTTACTATCTAACT 3. How did you know whether the gene was on the top or bottom strand?. Bellwork. Grade hmw .

★ ★ ★ ★ ★

569 views • 43 slides

Ch. 11.4 & 11.5: Transcription & Translation

Ch. 11.4 & 11.5: Transcription & Translation. Objectives: Explain one-gene-one polypeptide hypothesis. Describe the process of transcription. Explain how RNA is edited. Describe how RNA is translated into a protein. Describe how amino acids are coded. Summarize protein synthesis. Vocab.:

★ ★ ★ ★ ★

494 views • 14 slides

View Ne5ms2ls PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Ne5ms2ls PowerPoint presentations. You can view or download Ne5ms2ls presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.

'Ne5ms2ls' presentation slideshows

Ne5ms2ls - PowerPoint PPT Presentation

Translation

Ch. 11.4 &amp; 11.5: Transcription &amp; Translation

Ch. 11.4 & 11.5: Transcription & Translation