Classification technique - PowerPoint PPT Presentation

Business Systems Intelligence: 5. Classification 2

Dr. Brian Mac Namee ( www.comp.dit.ie/bmacnamee ). Business Systems Intelligence: 5. Classification 2. Acknowledgments. These notes are based (heavily) on those provided by the authors to accompany “Data Mining: Concepts &amp; Techniques” by Jiawei Han and Micheline Kamber

★ ★ ★ ★ ★

635 views • 49 slides

Overview of Part II, CMSC5707 Advanced Topics in Artificial Intelligence KH Wong

Overview of Part II, CMSC5707 Advanced Topics in Artificial Intelligence KH Wong. Audio signal processing Signals in time &amp; frequency domains Audio feature extraction techniques Time/Frequency domain Linear predicted coding Vector quantization Cepstral coefficients

★ ★ ★ ★ ★

250 views • 2 slides

A Self-Tuning Method for One-Chip SNP Identification

= Conformer. = Non-Conformer. C. N. (complement of) Reference Sequence: AAGCATATATCCATCCTAGCATACGATCTTTATACTTAC…. C. C. Probably Bad Data. N. C. C. C. A Likely SNP. Quartet 1:

★ ★ ★ ★ ★

107 views • 1 slides

View Classification technique PowerPoint (PPT) presentations online in SlideServe. SlideServe has a very huge collection of Classification technique PowerPoint presentations. You can view or download Classification technique presentations for your school assignment or business presentation. Browse for the presentations on every topic that you want.