'Alignments' presentation slideshows

The Basic Local Alignment Search Tool (BLAST)

1.7k views • 143 slides

Advances and Limitations of Maximum Likelihood Phylogenetics

797 views • 64 slides

Advances and Limitations of Maximum Likelihood Phylogenetics

769 views • 64 slides

Bio 101: Genomics & Computational Biology

Bio 101: Genomics & Computational Biology. Tue Sep 18 Intro 1: Computing, statistics, Perl, Mathematica Tue Sep 25 Intro 2: Biology, comparative genomics, models & evidence, applications Tue Oct 02 DNA 1: Polymorphisms, populations, statistics, pharmacogenomics, databases

717 views • 54 slides

Pairwise sequence alignments

Pairwise sequence alignments. Dynamic programming (Needleman-Wunsch), finds optimal alignment Heuristics: Blast (Altschul et al) does not guarantee finding optimal alignment, but fast. Pairwise sequence alignments. AP L F V A ---- ITRS DD AP V F I A GDTR ITRS EE Assumptions:

693 views • 41 slides

Evolution and the Santa Cruz Genome Browser

Evolution and the Santa Cruz Genome Browser. Jim Kent and the Genome Bioinformatics Group University of California Santa Cruz Pennsylvania State University. Typical Gene Level View:. Sialic Acid Binding/Ig-like Lectin 7. Typical Gene Level View:. Sialic Acid Binding/Ig-like Lectin 7.

499 views • 40 slides

creativecommons/licenses/by-sa/2.0/

507 views • 39 slides

Applications of Dynamic Programming

Applications of Dynamic Programming. To sequence analysis Shotgun sequence assembly Multiple alignments Dispersed & tandem repeats Bird song alignments Gene Expression time-warping 3D-structure alignment Through HMMs RNA gene search & structure prediction Distant protein homologies

427 views • 39 slides

From DoTS Assemblies to Genes via Genomic Alignment

362 views • 36 slides

Introduction to NCBI & Ensembl tools including BLAST and database searching

Introduction to NCBI & Ensembl tools including BLAST and database searching. Incorporating Bioinformatics into the High School Biology Curriculum. Fran Lewitter, Ph.D. Founding Director, Bioinformatics & Research Computing Whitehead Institute for Biomedical Research

295 views • 28 slides

COFFEE: an objective function for multiple sequence alignments

COFFEE: an objective function for multiple sequence alignments. Wang Yi Computational Genomics Group Bioinformatics Institute. Why MSA. Multiple Sequence Alignments (MSA) are among the most important tools for analyzing biological sequences Useful for: Structure prediction

385 views • 26 slides

Bioinformatics (4)

Bioinformatics (4). Sequence Analysis. DNA2: the last 5000 generations. NA1: Common & simple. Sequence Similarity and Homology. figure. Alignments & Scores. Local (motif) ACCACACA :::: ACACCATA Score= 4(+1) = 4. Global (e.g. haplotype) ACCACACA ::xx::x: ACACCATA

350 views • 25 slides

Hidden Markov Modeling, Multiple Alignments

Hidden Markov Modeling, Multiple Alignments and Structure. Bioinformatic Modeling Techniques Student: Patricia Pearl. The basic notion of a hidden Markov model was covered during the class lectures and in our midterm.

325 views • 20 slides

Minimum Edit Distance

Minimum Edit Distance. Minimum Edit Distance in Computational Biology. Sequence Alignment. AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC. - AG G CTATCAC CT GACC T C CA GG C CGA -- TGCCC --- T AG - CTATCAC -- GACC G C -- GG T CGA TT TGCCC GAC. Why sequence alignment?.

279 views • 17 slides

A Million-Fold Speed Improvement in Genomic Repeats Detection

John W. Romein Jaap Heringa Henri E. Bal. A Million-Fold Speed Improvement in Genomic Repeats Detection. Vrije Universiteit Faculty of Sciences, Department of Computer Science Bio-Informatics Group & Computer Systems Group Amsterdam, the Netherlands. Vrije Universiteit , Amsterdam.

214 views • 14 slides

Duluth Word Alignment System

Duluth Word Alignment System. Bridget Thomson McInnes Ted Pedersen University of Minnesota Duluth Computer Science Department. 31 May 2003. Duluth Word Alignment System. Perl implementation of IBM Model 2 Learns a probabilistic model from sentence aligned parallel corpora

284 views • 12 slides

From DoTS Assemblies to Genes via Genomic Alignment

105 views • 10 slides

RNASTAR, Greengenes , and QIIMEdb

RNASTAR, Greengenes , and QIIMEdb. Rob Knight HHMI/CU Boulder. What: collection of RNA alignments backed by crystal or NMR structures (148 alignments, 9600 unique seqs ), cleaned up for isostericity (83% -> 94 isosteric bp )

123 views • 6 slides

Quality filtering using ConvertGerald Convert reads to fasta format

Quality filtering using ConvertGerald Convert reads to fasta format. Extract coordinates for exon, transcript, gene, non-coding regions. Align reads to the genome (with Eland software ) allowing up to10 perfect alignments up to 5 alignments with 1-mismatch

99 views • 2 slides

et al SUPPLEMENTAL Fig corrected Jan2005

59 views • 1 slides