saxon
Uploaded by
20 SLIDES
405 VIEWS
220LIKES

Systematic random libraries versus classical mutagenesis

DESCRIPTION

Systematic random libraries versus classical mutagenesis. Classical mutagenesis Chemical or physical mutagenesis Collection of random mutants Analysis restricted to a limited number of genes (cloning by complementation and sequencing of the gene is time consuming).

1 / 20

Download Presentation

Systematic random libraries versus classical mutagenesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Systematic random libraries versus classical mutagenesis • Classical mutagenesis • Chemical or physical mutagenesis • Collection of random mutants • Analysis restricted to a limited number of genes • (cloning by complementation and sequencing of the gene is time consuming) • Large scale systematic random library • Transposon insertion mutants • Collection of random mutants • Large scale (genomic level) and systematic gene analysis • (gene sequence determination by PCR amplification of the yeast DNA sequences)

  2. Insertion of transposon in yeast by homologous recombination Lacz LEU2 Amp Transposon mTn Library of mTn insertions in yeast DNA Not1 Not1 Yeast DNA Transform yeast with Not1 excised DNA Not1 Not1 Yeast chromosome

  3. Construction of a transposon insertional library • RECIPIENT STRAIN • --- Construction of a yeast genomic library • Sau3A digests (1-3kb) of yeast DNA ligated into vector • Selective marker in bacteria: Chloramphenicol • Bacterial strain B211 contains transposase Not1 Yeast DNA Not1 Transposon • DONOR STRAIN • Bacterial strain B198 contains transposon • Selective marker: Ampicillin Lacz LEU2 Amp • DONOR AND RECIPIENT STRAINS ARE MIXED AND TRANSPOSITION OCCURS: COINTEGRATES • Mate to bacterial strain R1230 that contains resolvase to resolve co-integrates, extract plasmid DNA and transform in a regular bacterial strain • Select hundreds of thousands of clones Not1 Not1

  4. Generation of a yeast mutant library in yeast • Transformant bacteria are used to extract the plasmid DNA containing the yeast DNA with inserted transposons and 15-20 independent pools of plasmid DNA are prepared and used to transform yeast. Pools of yeast DNA • A complete library of yeast mutants is thus created • Systematic sequence analysis of the insertion site of the transposon • Search for phenotype deficiency families • Inability to grow on glycerol, in the presence of specific drugs etc... • New open reading frames

  5. Multi-purpose transposon Transposon YEAST YEAST HA tag URA3 tet lacz loxP loxR Transformation and homologous recombination into yeast Cre-lox recombinase ATG In-frame fusion Protein localisation

  6. How to determine the insertion site: the Vectorette PCR Strategy: Specific amplification of the yeast genomic DNA flanking one side of the transposon for direct sequencing without yeast DNA cloning Yeast genomic DNA digested with Alu1 Anchor bubble mTn3 LIGATION mTn3 PCR

  7. PCR with mTn3 and bubble primers First cycle Second cycle mTn3 Anchor bubble primers GAGAGGGAAGAGAGCAGGCAAGGAATGGAAGCTGTCTGTCGCAGGAGAGGAAG GACTCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTC

  8. Systematic deletion of all ORFs of Saccharomyces cerevisiae • Construction of deletion cassettes by PCR in Stanford • Deletion cassettes divided into batches send to the labs • Replacement of the gene by the deletion cassette by homologous recombination • Deletion in MATalpha, MATa haploids, heterozygous and homozygous diploids • PCR verification of the deleted loci • Construction of a database containing all deletion strains in Stanford • Collection of deleted strains in Euroscarf, Research Genetics, Stanford, ATTC Yeast homology Barcode UP Barcode Down Yeast homology KanR 20 bp 45 bp 45 bp 20 bp 1500 bp

  9. External medium Plasma membrane Cytosol Siderophore transporters Siderophores are utilized but are not produced by yeast Siderophores Redundant homologous siderophore transporters IRON IRON Fe3+ Redundant iron transport systems Fe2+ High affinity transporter Low affinity transporter

  10. Redundant functions and gene families • An example: • The iron transport system through the plasma membrane of S. cerevisiae • Life of yeast strains in a laboratory and in natural environment are different, or why the iron uptake genes used in the wild were missed by the scientists • Siderophores are not produced by S. cerevisiae but they are used by this yeast • Four distinct homologous genes (ARN1-4) are used for transport of siderophores • Iron can also be transported through high affinity and low affinity transporters

  11. Verification of the deletion cassette by PCR Disruption cassette Original gene 5 ’ A KanC A C Kan B D B D Only these bands in haploids No bands in haploids

  12. Utilization of the deletion strains at the genomic level • All UP and DOWN barcodes have been gridded on chips • Large pools of deletants have been grown under different conditions • DNAs have been extracted, PCR-amplified and hybridized to DNA chips with the oligonucleotides of the barcodes • Identification of resistant or sensitive mutants in a quantitative way A major drawback to this otherwise very useful mutant library Multiple Gene deletions cannot be constructed because the deletion cassettes cannot be excised from the yeast genome

  13. Gene disruption by homologous recombination Disruption cassette Yeast DNA Marker Yeast DNA Gene Chromosome The gene of interest is replaced by the deletion cassette by recombination between homologous yeast DNA sequences

  14. For approximatively 1700 genes, the function remains UNKNOWN WHY? --- Subtle function : it is like to find a needle in a haystack --- Gene family or redundant pathway • Search for ‘ synthetic lethal ’ mutants • Mutant 1 is viable • Mutant 2 is viable • Mutant 1+ 2 is lethal • The mutated genes can encode interacting proteins in a complex • The mutated genes can encode proteins in redundant pathways

  15. Each deletion is characterized by a distinct antibiotic resistance maker Only Mata strains grow without histidine Only strains with two deletions grow in the presence of the two antibiotics

  16. SYNTHETIC LETHAL INTERACTIONS

  17. Any largescale mutant library must be used with caution Deletion may be incorrect and a copy of the wild-type gene can still be present Yeast transformation may generate second site mutations in another unrelated gene. To avoid artefactual phenotypes homozygous deleted diploids must be used Yeast frequently becomes ANEUPLOID for genes (duplication) or part of chromosome Example: Deletion of RNR1 is LETHAL Deletion of RNR1 was not lethal in the Stanford collection The close homologue of RNR1 called RNR3 has been duplicated

More Related