1 / 25

The role of parallel genetic changes in domestication: Fruit size in the plant family Solanaceae

The role of parallel genetic changes in domestication: Fruit size in the plant family Solanaceae. Matt Robinson. Outline. Background Proposed Research Amplicons CAPs dCAPs. Outline. Background Proposed Research Amplicons CAPs dCAPs. Background .

sasha
Download Presentation

The role of parallel genetic changes in domestication: Fruit size in the plant family Solanaceae

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. The role of parallel genetic changes in domestication: Fruit size in the plant family Solanaceae Matt Robinson

  2. Outline • Background • Proposed Research • Amplicons • CAPs • dCAPs

  3. Outline • Background • Proposed Research • Amplicons • CAPs • dCAPs

  4. Background • In tomato studies 28 QTLs have been identified as responsible for fruit weight variance. • Similar studies have been done in eggplant and pepper. • In these studies there has been several tomato QTLs which have homologs in the other species.

  5. From: Ben Chaim et al. 2001, Donganlar et al. 2002

  6. Background • In tomato studies 28 QTLs have been identified as responsible for fruit weight variance. • Similar studies have been done in eggplant and pepper. • In these studies there has been several tomato QTLs which have homologs in the other species. The major of these being Fw 2.2.

  7. QTL • Quantitative Trait Loci (QTL) is a region of any genome that is responsible for variation in the quantitative trait of interest. • You can use QTL as a powerful mapping tool when comparing the evolution of a trait between and within members of a species

  8. Mapping Population • Use a F2 population. • Cross a small fruited wild type with a large fruited domesticated type. • Cross the resulting F1 generation to obtain the F2 generation. • The resulting F2 generation will be used to genotype all the markers. • The fruit weight of each individual will be measured.

  9. Small Fruited Large Fruited

  10. Mapping Population • Use a F2 population. • Cross a small fruited wild type with a large fruited domesticated type. • Cross the resulting F1 generation to obtain the F2 generation. • The resulting F2 generation will be used to genotype all the markers. • The fruit weight of each individual will be measured.

  11. Parental F1 F2

  12. Outline • Background • Proposed Research • Amplicons • CAPs • dCAPs

  13. Proposed Research • Use 12 most common QTL in tomato. • Seeing if Fw2.2 plays an important role in Physalis • Using F2 population • Testing using Amplicons, CAPs, dCAPs

  14. Outline • Background • Proposed Research • Amplicons • CAPs • dCAPs

  15. Amplicons • Detect size differences between the introns sequences of DNA. • Run through thick gel matrix.

  16. Outline • Background • Proposed Research • Amplicons • CAPs • dCAPs

  17. CAPs • Cleaved Amplified Polymorphic Sequence analysis (CAPs). • Changes in the base sequence which causes a loss or a gain of a restriction site. • This can be used to see which allele the offspring was given by comparing the banding patterns of either parent with the offspring.

  18. 1 kb 4 kb 5 kb | = restriction enzyme site From: http://www.ndsu.nodak.edu

  19. Outline • Background • Proposed Research • Amplicons • CAPs • dCAPs

  20. dCAPs • Derived Cleaved Amplified Polymorphic Sequence analysis (dCAPs). • Induce a restriction site by placing it into a PCR primer. This primer binds to mismatches in the DNA template. • Then the PCR product is digested by the restriction enzyme and run through a gel.

  21. Bs1I dCAPS assay: La-er GTGGAAGAAGCTCGATGAGGCTTTGGGG phyB-9 GTGGAAGAAGCTCGATGAGGCTTTGAGG Bs1I CCNNNNNNNGG The B9dCAP primer GTGGAAGAAGCTCGACCAGGCTTTGGGG Bs1I digestion: La-er GTGGAAGAAGCTCGACCAGGCT / TTGGGG phyB-9 GTGGAAGAAGCTCGACCAGGCTTTGAGG From: Neff et al.

  22. The Big Picture • Able to see the special qualities about the region • These linked regions (QTLs) have been seen in other types of domestication

  23. The end

More Related