1 / 1

Genetic Replication Mechanisms and Transcription Processes in Eukaryotes

Explore the intricate genetic replication and transcription mechanisms in eukaryotic organisms, including minus-strand priming sites, plus-strand primers, polyadenylation consensus sequences, splice donor and acceptor sites. Uncover the details of genetic processes crucial for cellular functions.

santo
Download Presentation

Genetic Replication Mechanisms and Transcription Processes in Eukaryotes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. a. Replication (i) Minus-strand priming site (ii) Plus-strand primer 4321 CGCCCGCCATTATTTTCAAACATTCCTGAAA 4329 ............................... 4327 ............................... 4329 .AAAGA..CC................A.... Ph Ch Se SA 1 TGGTATCAGAGCGATGTT 1 .................. 1 .................. 1 .................. 1 ............A..... Ph Ch Se Wb/Kk Ap/Pb SEA SEA SA b. Transcription Polyadenylation consensus TSS TATA box 7373 TATATAA—(N)24—TC—(N)192—AATAAA 7381 .......—(N)24—..—(N)193—...... 7381 .......—(N)27—..—(N)195—...... 7359 .......—(N)25—CA—(N)197—...... 7359 .......—(N)25—CA—(N)197—...... 7327 .......—(N)25—CA—(N)203—...... 7353 .......—(N)25—CA—(N)202—...... Ph Ch Se Wb Kk Ap Pb SEA SA c. Splicing Splice donor site Splice acceptor site Eukaryotic consensus Eukaryotic consensus Ph Ch Se Wb Kk Ap Pb 7495 ATGGCTCAGgtcagtgagtag —(N)6456— 5970 cagGGACA 7504 ..................... —(N)6460— 5975 ........ 7508 ..................... —(N)6457— 5970 ........ 7487 ..................... —(N)6398— 5972 ....ATA. 7487 ..................... —(N)6397— 5972 ....ATA. 7460 ..................... —(N)6398— 5942 ....ATA. 7486 ..................... —(N)6396— 5972 ....ATA. A/CAG GTPu AGT CAG G SEA SA sORF1 5’ of ORF IV Spliced Supplementary Fig. 1

More Related