slide1 n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
DNA Structure PowerPoint Presentation
Download Presentation
DNA Structure

Loading in 2 Seconds...

play fullscreen
1 / 67

DNA Structure - PowerPoint PPT Presentation


  • 98 Views
  • Uploaded on

Welcome to Molecular Biology Through Discovery Tuesday, 17 September 2013 DNA Structure / Benzer (1959). Finally found a mentor! Is there anything that we should physically or electronically be turning in as proof?. DNA Structure.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'DNA Structure' - sancha


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide2

Welcome toMolecular Biology Through DiscoveryTuesday, 17 September 2013DNA Structure / Benzer (1959)

Finally found a mentor!Is there anything that we should physically or electronically be turning in as proof?

slide3

DNA Structure

A class discussion on the tetranucleotide hypothesis might help.

ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ...

slide4

DNA Structure

ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ...

TAGGCCACTGCCCAACCCTCCATCATAAAACTTGGGCTTGGGAGGCAGAGCCTAACCTCTCTCACTCTAGACAGGTCTAAGATGATTGGGAACGAAATGAGCCGTCTCGACTTTTTCGCGAAGTGGCTAA ...

#1: Hello!

#2: Complete description of our civilization

slide6

DNA Structure

SQ7. What would you expect to happen to the diffraction pattern if the helix shown in Fig. 8B-D were squashed, i.e. the helix were more tightly wound, more like a solenoid?

slide7

DNA Directionality & Palindromes

…would like to go into deeper discussion about palindromic sequences

slide8

Backwards = forwards

AGTTGA

  • DNA is double stranded

ROTATOR

TTAATGTGAGTTAGCTCACTCATTAATTACACTCAATCGAGTGAGTAA

Palindromic Sequences

SQ16. … why is AGTTGA not a DNA palindrome?

What is it?

What about with DNA?

slide9

Backwards = forwards

AGTTGA

ROTATOR

Palindromic Sequences

What is it?

What about with DNA?

  • DNA is double stranded
  • DNA is redundant

TTAATGTGAGTTAGCTCACTCATTAATTACACTCAATCGAGTGAGTAA

slide10

Backwards = forwards

AGTTGA

ROTATOR

TTAATGTGAGTTAGCTCACTCATT

AATGAGTGAGCTAACTCACATTAA

Palindromic Sequences

What is it?

What about with DNA?

  • DNA is double stranded
  • DNA is redundant
  • DNA has direction (read 5’->3’)

5’- -3’

3’- -5’

TTAATGTGAGTTAGCTCACTCATTAATTACACTCAATCGAGTGAGTAA

slide11

TAT GGCATGCTAGCTTAAT TCATTAATTA AGTAACGTACGATCGG TAT

DNA: cruciform

RNA: stem/loop

Palindromic Sequences

The full biological roles of palindromic sequences is still a bit unclear to me

Palindromic sequences as structural RNA

5’- -3’

3’- -5’

TTAATGTGAGTTAGCTCACTCATTAATTACACTCAATCGAGTGAGTAA

SQ18. What is the relationship between a palindromic sequence and a potential hairpin structure?

slide12

UAU GGCAUGCUAGCUUAAU UCAUU

tRNA

DNA: cruciform

RNA: stem/loop

Palindromic Sequences

Palindromic sequences as structural RNA

5’- -3’

3’- -5’

TTAATGTGAGTTAGCTCACTCATTAATTACACTCAATCGAGTGAGTAA

slide13

TTAATGTGAGTTAGCTCACTCATT

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNN

AATGAGTGAGCTAACTCACATTAA

recognizes GTGAGTT

Palindromic Sequences

Palindromic sequences as protein binding sites

slide14

TTAATGTGAGTTAGCTCACTCATT

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNN

AATGAGTGAGCTAACTCACATTAA

Palindromic Sequences

Palindromic sequences as protein binding sites

slide15

Palindromic Sequences

Palindromic sequences as protein binding sites

TTAATGTGAGTTAGCTCACTCATT

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNN

AATGAGTGAGCTAACTCACATTAA

slide16

Palindromic Sequences

Palindromic sequences as protein binding sites

TTAATGTGAGTTAGCTCACTCATT

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNN

AATGAGTGAGCTAACTCACATTAA

slide17

Palindromic Sequences

Palindromic sequences as protein binding sites

TTAATGTGAGTTAGCTCACTCATT

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNN

AATGAGTGAGCTAACTCACATTAA

slide18

Palindromic Sequences

Palindromic sequences as protein binding sites

TTAATGTGAGTTAGCTCACTCATT

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNN

AATGAGTGAGCTAACTCACATTAA

recognizes GTGAGTT

slide19

Palindromic Sequences

Palindromic sequences as protein binding sites

TTAATGTGAGTTAGCTCACTCATT

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNN

AATGAGTGAGCTAACTCACATTAA

slide20

Palindromic Sequences

Palindromic sequences as protein binding sites

TTAATGTGAGTTAGCTCACTCATT

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNN

AATGAGTGAGCTAACTCACATTAA

slide21

Palindromic Sequences

Palindromic sequences as protein binding sites

TTAATGTGAGTTAGCTCACTCATT

NNNNNNNNNNNNNNNNNNNNNNNNNNNNNN

NNNNNNNNNNNNNNNNNNNNNNNNNN

AATGAGTGAGCTAACTCACATTAA

Palindromes: Serve as binding sites for dimeric protein

slide22

RNA Polymerase

Palindromic Sequences

Palindromic sequences as protein binding sites

gene

5’-GTA ..(8).. TACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN3’-CAT ..(8).. ATGNNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN

GTA ..(8).. TAC

slide23

gene

5’-GTA ..(8).. TACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN3’-CAT ..(8).. ATGNNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN

Transcription factor

RNA Polymerase

Palindromic Sequences

Palindromic sequences as protein binding sites

RNA

GTA ..(8).. TAC

5’- -3’

3’- -5’

TTAATGTGAGTTAGCTCACTCATTAATTACACTCAATCGAGTGAGTAA

How many 12-nt palindromes would you expect at random in the genome of Anabaena variabilis?

slide25

Probability

How often A-A-A-A-A-A?

slide26

Probability

How often 1-1-1-1-1-1?

slide27

Probability

How often A-A-A-A-A-A?

slide28

Probability

How often 1-1-1-1-1-1?

slide29

Probability

How often 1-2-1-1-1-1?

slide30

Probability

How often 1-1-1-1-1-1?

slide31

Probability

How often 1-1-1-1-1-1?

slide32

Probability

How often A-A-A-A-A-A?

slide33

Probability

How often A-T-G-G-T-A?

slide34

Counting

Probability

How often A-T-G-G-T-A?

slide35

gene

5’-GTA ..(8).. TACNNNNNNNNNNTANNNTNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGNNNNNNNNNNNNNNNN3’-CAT ..(8).. ATGNNNNNNNNNNATNNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNTACNNNNNNNNNNNNNNNN

Transcription factor

Palindromic Sequences

Palindromic sequences as protein binding sites

RNA

GTA ..(8).. TAC

5’- -3’

3’- -5’

TTAATGTGAGTTAGCTCACTCATTAATTACACTCAATCGAGTGAGTAA

How many 12-nt palindromes would you expect at random in the genome of Anabaena variabilis?

slide36

Welcome toMolecular Biology Through DiscoveryTuesday, 17 September 2013DNA Structure / Benzer (1959)

slide37

Fermi Problems

What is the question?

slide38

Fermi Problems

  • Focus on what is being asked
  • Estimate what can be estimated
  • Set limits on what can't

How many piano tuners are there in Chicago?

slide39

Fermi Problems

  • Focus on what is being asked
  • Estimate what can be estimated
  • Set limits on what can't

What fraction of the cells in your body are bacterial?

slide40

Fermi Problems

What is the question?What do you need?

slide41

Benzer (1959)

Hoping you will go over the experiment.It is so hard to visualize what goes down in a lab without actually laying on hands.

slide42

Wrinch (1936) – What is a Gene?

Drosophila

chromosome

What are genes?... There is no consensus of opinion amongst geneticists as to what the genes are – whether they are real or purely fictitious...

Morgan T (1934) Nobel Lecture

slide45

Benzer (1959)

Complementation Test

slide46

Benzer (1959)

Phage

Complementation Test

E. coli

slide48

Benzer (1959)

Phage

Recomination Test

(Cis-Trans Test)

Measuredistance

E. coli

slide49

Benzer (1959)

Phage

Recomination Test

(Cis-Trans Test)

Measuredistance

E. coli

slide50

Benzer (1959)

Phage

Complementation Test?

Recombination Test?

E. coli

slide51

Benzer (1959)

SQ2. Is there any reason to believe from classical genetics that genes have internal structure?

Whatis aGene?

slide52

Benzer (1959)

rII region of bacteriophage T4

What do you need for the experiment?

slide53

Benzer (1959)

rII region of bacteriophage T4

mutation

slide62

Benzer (1959)

rII region of bacteriophage T4

slide63

Benzer (1959)

Determine distances between markers byRecombination

slide64

Benzer (1959)

I still have trouble connecting recombination with the distance b/w genetic markers.

slide65

Benzer (1959)

I still have trouble connecting recombination with the distance b/w genetic markers.

Richard Twyman, University of Warwick

slide66

Benzer (1959)

I still have trouble connecting recombination with the distance b/w genetic markers.

Elizabeth Ellis University of Strathclyde

slide67

Goodbye fromMolecular Biology Through DiscoveryThursday, 19 September 2013

ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ACTG ...

G-O-O-D-B-Y-E