1 / 39


A T G G T T A AC T A G T T A G G A A T C G C G C A T T A T G T C C. A C G G T A. A C G T T A G G T T G A A C G G C A G G T T T A A A T C G A T T C C. C A G A T. A C G T T A T G A A A T T G G G G C A G G T T T A A C G C G C C C. M. V. N. M. S. T.

Download Presentation


An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.


Presentation Transcript

  1. A T G G T T A AC T A G T T A G G A A T C G C G C A T T A T G T C C A C G G T A A C G T T A G G T T G A A C G G C A G G T T T A A A T C G A T T C C C A G A T A C G T T A T G A A A T T G G G G C A G G T T T A A C G C G C C C

  2. M V N M S T K P Prolina Lisina G Glicina V P Leucina L Glutamina Q M K L G Q V M Metionina N Asparagina S Serina V Valina STOP T Treonina A U G G UU A A C U A G UU A G G A A U C G C G C A U U A U G U C C A C G G U A A C G U U A G G U U G A A C G G C A G G U U U A A A U C G A U U C C C A G A U A C G U U A UG A A A U U G G G G C A G G U U U A A C G C G C C C

  3. presente in ? algoritmo che richiede un numero di confronti pari alla lunghezza di ATTACGGCCATGCGGAGCCGGAAG CCATG

  4. T G T A C G G A A T C G G A T C T C C G A C C A T C G G A 4 T G - T A - C G G A - - A T C G G A + T - C T - C C G - A C C A T C G G A = 3 7 confronto approssimato di stringhe ALLINEAMENTO T G C TAC C G G A C C A T C G G A

  5. T C T T C T C C G C C G A C C A C C A T C A T C G G A G G A T G T A C G G A A T C G G A T G T A C G G A A T C G G A

  6. 4 T G - T A - C G G A - - A T C G G A + T - C T - C C G - A C C A T C G G A = 3 7 T - G T A C - G G A - - A T C G G A T C - T - C C - G A C C A T C G G A

  7. cammino minimo quante operazioni ? N.B. : il numero di cammini è molto elevato impossibile la valutazione esplicita !

  8. +1 min = +1 RICORSIONE !

  9. numero operazioni = numero archi = ogni arco viene considerato esattamente una volta due sequenze di 1000 basi richiedono un milione di operazioni

  10. T G T A C G G A A T C G G A 4 T G T A C G G A - - A T C G G A T C T C C G A C C A T C G G A 2 T C T C C G - A C C A T C G G A 2 8 Diverso modello: sostituzioni ammesse

  11. T C T 14 C C G A C C 6 A T C G G A T G T A C G G A A T C G G A

  12. T G T A C G G A - A T C G G A T G T A C G G A - - A T C G G A T C T C C G A C C A T C G G A T C T C C G - A C C A T C G G A


  14. un miliardo di operazioni ! Numero confronti = prodotto lunghezze stringhe 3 stringhe lunghe 1000


  16. AUGCCGAUUCAACGGUCCUACUCGGACUUUACC M P I Q R S Y S D F T M R I S R S D S D Y T punteggio (M<->M, P<-> R ...) basato sulle probabilità di mutazione




  20. 1 + 1 + 2 = ___ 4 ACCGT CGTGC TTAC TACCGT - - ACCGT - - - - - - CGTGC TTAC - - - - - - TACCGT - - TTACCGTGC TTAC - - - - - - TACCGT - - - - ACCGT - - - - - - CGTGC


  22. 4 4 TAGG 1 3 4 4 GTCG AGGT 2 1 4 2 4 4 CGTC CGTC - GTCG - - - - TAGG - AGGT CGTCGTAGGT lunghezza 10

  23. TAGG 1 4 4 3 4 4 GTCG AGGT 2 TAGG 1 4 2 4 - AGGT 4 - - GTCG CGTC - - CGTC TAGGTCGTC lunghezza 9 CGTCGTAGGT


  25. 0 0 1 0 1 1 0 0 1 1 1 1 0 1 0 0 0 1 0 1 0 1 0 1 1 1 0 1 0 0 a b c d e A B C D E F

  26. 00110 00010 00100 10010 00011 00101 00100 01011 00010 10011 10010

  27. 1 0 1 0 0 1 1 0 0 0 0

  28. 0 0 0 0 1 1 0 1 0 1 0

  29. 1 0 1 0 0 1 1 0 0 0 0

  30. 0 0 1 0 1 1 0 0 1 1 1 1 0 1 0 0 0 1 0 1 0 1 0 1 1 1 0 1 0 0 a b c d e A B C D E F esiste un albero filogenetico perfetto con A,B,C,D,E,F nodi?

  31. A B B A C A B A C C B 12 6 18 60 30 30 120 2 foglie 3 foglie 4 foglie 5 foglie

  32. 0 0 1 0 1 a b c d e 1 0 0 1 1 A 1 1 0 1 0 B 0 0 1 0 1 C 0 1 0 1 1 D 1 0 1 0 0 E F caratteri ordinati: solo 0 --> 1 ammesso problema facile

  33. 0 0 1 0 1 1 0 0 0 0 1 1 0 1 0 0 0 1 0 0 0 0 0 0 0 1 1 0 0 0 a b c d e A B C D E F

  34. a b c d e A 0 0 1 0 1 B 1 0 0 0 0 C 1 1 0 1 0 a D 0 0 1 0 0 b c a b c d e 0 0 0 0 0 E A 0 0 1 0 1 1 1 0 0 0 F d B B E e 1 0 0 0 0 C 1 1 0 1 0 D 0 0 1 0 0 C F A D 0 0 0 0 0 E 1 1 0 0 0 F

  35. a b c d e f g a b c d e f g A 0 1 0 1 0 0 0 1 0 0 0 1 0 1 A B 0 1 0 1 0 0 1 0 1 1 0 0 1 1 B C 0 1 0 1 0 0 1 0 0 0 1 1 0 0 C D 0 1 1 0 0 0 1 0 0 1 0 1 0 0 D 0 1 0 1 1 1 0 1 0 1 0 1 0 0 E E 1 0 0 1 0 0 1 0 0 0 1 0 0 1 F F caratteri non ordinati (filogenia perfetta)

  36. 1001011 1101011 1001010 0101011 1101011 1001010 1001010 E B 1101011 0101011 C 0100011 F 1101001 D A

More Related