biological weapons a counterterrorism perspective n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Biological Weapons A Counterterrorism Perspective PowerPoint Presentation
Download Presentation
Biological Weapons A Counterterrorism Perspective

Loading in 2 Seconds...

play fullscreen
1 / 17

Biological Weapons A Counterterrorism Perspective - PowerPoint PPT Presentation


  • 91 Views
  • Uploaded on

Biological Weapons A Counterterrorism Perspective. University of California Lawrence Livermore National Laboratory J. Patrick Fitch, Ph.D. Program Leader Chemical & Biological National Security October 19, 2005. UCRL-PRES-151152 Version 051019

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Biological Weapons A Counterterrorism Perspective' - sabin


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
biological weapons a counterterrorism perspective

Biological WeaponsA Counterterrorism Perspective

University of California

Lawrence Livermore National Laboratory

J. Patrick Fitch, Ph.D.

Program Leader

Chemical & Biological National Security

October 19, 2005

UCRL-PRES-151152 Version 051019

For additional information contact J.P. Fitch at fitch2@llnl.gov

This work was performed under the auspices of the U.S. Department of Energy by the

University of California, Lawrence Livermore National Laboratory under Contract No. W-7405-Eng-48.

the public is exposed to a lot of information about potential biological attacks
The public is exposed to a lot of information about potential biological attacks
  • Initiation of BioWatch at the State of the Union on January 28, 2003: “…deploying the nation's first early warning network of sensors to detect biological attack”

What are the key issues around BW and BW defense?

What are distractions?

biosecurity is a multifaceted problem that requires integrating many disparate components
Biosecurity is a multifaceted problem that requires integrating many disparate components
  • Link all of these components into a coherent architecture

Anticipate Prepare Prevent Detect Response Attribute

Biosecurity Components

  • Data
  • Collections
  • All source
  • Directed discovery
  • Pathogen biology
  • Infectivity
  • Signatures
  • Manipulation
  • Threats
  • Weaponized
  • GM
  • Individual
  • State sponsored
  • Validation
  • Signatures
  • Assays
  • Processes
  • Chain-of-custody
  • Vaccines
  • Development
  • Efficacy
  • Deployment
  • Surveillance
  • Sensitivity
  • Specificity
  • Response
  • Interpretation
  • Feasibility
  • Intent
  • Backgrounds
  • Natural
  • Manufacturing
  • Epidemiology
  • Early detection
  • Privacy

Threat

Assessments

S&T

Knowledge Management

we would like to know even more
We would like to know even more!
  • BW attacks sound scary
    • Genetically modified threat
    • Bio Terror & Bio Error
  • “Mother Nature” as terrorist
    • Re-emergent diseases
    • Influenza

Discovery of 5 virulence-associated signatures

Northern Arizona University student

testing prairie dog colony

the human and economic impact of endemic pathogens can be amplified
The human and economic impact of endemic pathogens can be amplified
  • Modified
  • Genetic mods
  • Weaponized

Difficulty

Clever

Use

Endemic

Impact

The systems-level challenge is to

counter numerous potential threats

a stratified view of bioterrorist threats
A stratified view of bioterrorist threats

Level I (1 – 1000)

  • Scale?

Level II (1000 – 10,000)

Level III (>10,000)

Treatable (Plague)

Non-Treatable (Ebola)

  • Agent?

Contagious

Non-Contagious

  • Aerosol
  • Food supply
  • Water supply
  • Carrier

Treatable (Anthrax)

Non-Treatable (EEV)

To Prevent

To Protect

To Treat & / or Isolate

  • Detect?
looking for solutions there are significant benefits to early detection of a biological attack

Disease

  • Incubation period (days)
  • Intervention window (days)
  • Smallpox
  • 12 to 14
  • 3 to 4
  • Pulmonary Anthrax
  • 5 to 7
  • 1 to 2
  • Plague
  • 3 to 4
  • 1
  • Influenza
  • 2 to 5
  • 3
Looking for solutions: there are significant benefits to early detection of a biological attack
  • Treatments and quarantines must be administered early

A combination of complementary strategies

are needed for early detection

examples for preventing detecting and responding to wmd events

Contagious

Exposed

Examples for preventing, detecting, and responding to WMD events

Time

Prevent Environmental detection

Response and restoration

examples for preventing detecting and responding to wmd events1

Contagious

Exposed

Signatures

Forensics and

attribution

Backgrounds

Examples for preventing, detecting, and responding to WMD events

Prevent Environmental detection

Response and restoration

examples for preventing detecting and responding to wmd events2

Contagious

Exposed

Detect to prophylax

Detect to warn

Signatures

Forensics and

attribution

Backgrounds

Examples for preventing, detecting, and responding to WMD events

Prevent Environmental detection

Response and restoration

examples for preventing detecting and responding to wmd events3

Contagious

Exposed

Epidemiology to treat

Detect to prophylax

Consequence

management

Triage Dx

Detect to warn

Signatures

Forensics and

attribution

New strategies

?

Backgrounds

Examples for preventing, detecting, and responding to WMD events

Emerging

Threat

Prevent Environmental detection

Response and restoration

slide12
Developing new operational capabilities took several years and integration across multiple disciplines

Validated assays

GACAAAAGCGACAAAGGTTTTGTTCTTGGTCA

ATCCTCTCCTTTGCACGCCGTGGGACCAT

AGCTACAGATCACTTTACCTGCG.TGGGTGAACGCCGTGTGCGG

Genomics

Enabling

instrumentation

Cepheid

mTech

Smiths

early detection combined with models of dispersion are valuable
Early detection combined with models of dispersion are valuable
  • Bio attacks may not be visible
  • Want to act before symptoms present
  • Identify affected area / people / livestock
  • Prophylax, treat and clean-up
  • BUT timelines are not short enough!

Staten Island Fire

(Feb. 21, 2003)

>15- and >150-mg/m3 contours

what community norms can be established promoted or enforced
What community norms can be established, promoted or enforced?
  • Biological Weapons Convention is intent-based
  • US offensive BW program terminated in 1969
    • ‘Frozen’ perspective on BW
    • Recent investments in biodefense
  • Are BW the “poor man’s” nuke?
    • Role of deterrence?
    • What value does attribution provide?
    • When would a nation turn to BW?
    • When would a terrorist group?
    • Latency?
  • Contrast to other areas
    • OPCW, for example

Organization for the Prohibition of Chemical Weapons

there are critical shortfalls in the nation s infrastructure for dealing with bio terrorism
There are critical shortfalls in the nation’s infrastructure for dealing with bio-terrorism
  • Life science R&D exploding
    • Inherent “dual benefit”
    • Proliferating
    • 1969 out-of-date reference
    • BWC
  • Countermeasures not keeping up
    • Large cost and time from concept to regulatory approval
    • Increasing antibiotic and antiviral resistance
    • Few novel antibiotics in the pipeline
    • Vaccines not commercially attractive
  • Similar issues in agriculture and food

L

Product

Adversary 1

Adversary 2

Life Sciences

Capability

Countermeasure

Time

Countermeasure developers must adopt more rapidly than adversaries

disclaimer
Disclaimer
  • This document was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor the University of California nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights.
  • Reference herein to any specific commercial product, process, or service by trade name, trademark, manufacturer, or otherwise, does not necessarily constitute or imply its endorsement, recommendation, or favoring by the United States Government or the University of California. The views and opinions of authors expressed herein do not necessarily state or reflect those of the United States Government or the University of California, and shall not be used for advertising or product endorsement purposes.
  • This work was performed under the auspices of the U.S. Department of Energy by University of California, Lawrence Livermore National Laboratory under Contract W-7405-Eng-48.