1 / 6

Exon 2

oVM246. 3’ss. oVM245. Exon 3. oVM244. K8 β intron. …acacaagacagcugcagcag GUAUAGACGGGAAACAGGUGUCUAUCUUGGCCGGCUGGUUACUCAAAUGGGAACAAUGGCGCCACCUUGCUGUCUUUGUAG gcauuagaagaaaaggaugc…. oVM243. Exon 2. oVM242. STOP. 5’ss. oVM241. Figure S1. K8 β. 1. 2. 3. 4. RBM15. -. -. +. +. -.

ruby-tyler
Download Presentation

Exon 2

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. oVM246 3’ss oVM245 Exon 3 oVM244 K8β intron …acacaagacagcugcagcagGUAUAGACGGGAAACAGGUGUCUAUCUUGGCCGGCUGGUUACUCAAAUGGGAACAAUGGCGCCACCUUGCUGUCUUUGUAGgcauuagaagaaaaggaugc… oVM243 Exon 2 oVM242 STOP 5’ss oVM241 Figure S1

  2. K8β 1 2 3 4 RBM15 - - + + - ORF57 - + + K8 + + + + C N C N RNA C N C N - K8 - GAPDH U6 Figure S2

  3. A BCBL-1 0 6 12 24 32 56 VA (h) SRSF3 RBM15 - full ORF57 - cleaved β-tubulin SRSF3/RBM15 (%) 1 4 47 878 2220 2478 B HEK293 1000 ORF57 DNA (ng) 100 500 0 SRSF3 RBM15 - full - cleaved ORF57 β-tubulin Figure S3

  4. Supplementary Table S1: Peptides and corresponding proteins associated with KSHV ORF57 in THE absence (Fig 2A, sample 1) or presence (Fig 2A, sample 2) of ectopically expressed RBM15. The peptides and proteins were identified with LC-MS/MS.

  5. SUPPLEMENTARY TABLE S2. Biotinylated RNA oligos from the KSHV K8β intron region and the HPV16 ESE used in RNA pulldowns. Underlined are point mutations.

  6. Supplementary Table S3: Primers used for RT-PCR and Northern Blotting. T7, T7 promoter; U1bs, U1 binding site

More Related