slide1
Download
Skip this Video
Download Presentation
True or false: Amino acids are bonded together in long chains by what are known as peptide bonds.

Loading in 2 Seconds...

play fullscreen
1 / 70

True or false: Amino acids are bonded together in long chains by what are known as peptide bonds. - PowerPoint PPT Presentation


  • 109 Views
  • Uploaded on

Biology Journal 9/16/2014. 2.4 Homework Quiz!. True or false: Amino acids are bonded together in long chains by what are known as peptide bonds. True or false: The sequence of amino acids for a protein is found on code of the DNA.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'True or false: Amino acids are bonded together in long chains by what are known as peptide bonds.' - rockwell-kolby


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
slide1
Biology Journal 9/16/2014

2.4 Homework Quiz!

  • True or false: Amino acids are bonded together in long chains by what are known as peptide bonds.
  • True or false: The sequence of amino acids for a protein is found on code of the DNA.
  • How many different kinds of amino acids are used by ribosomes to make proteins?
  • What is a proteome?
slide3
Review!

a. What kind of molecule is this?

b. What are its parts called?

It’s an amino acid!

(this one is called asparagine)

R group

(in this case CH2CONH2)

Amine

(NH2)

Carboxyl

(COOH)

Alpha carbon

(the middle C where the R group is attached)

slide4
Protein and Amino Acids
  • Proteins do everything!
  • Protein makes skin stretchy, bones tough, gives your body parts their color, lets you digest different foods, makes up hormones, creates your immune system …
slide5
Proteins are 1 chain of amino acids (sometimes multiple), that fold up into specific shapes based on the chemical properties of the amino acids.
slide7
Generalized Amino Acid

How many amino acids make up this polypeptide?

what do ribosomes do
Ribosomes: part of the cell that makes proteins from an RNA copy of the DNA code. They join amino acids together with peptide bonds.What do ribosomes do?
slide10
There are infinite possibilities of proteins! They can be any length, and any combination of amino acids.

Turns garbage into bacon

Your welcome.

slide12
Proteins can irreversibly lose their specific shape through a process called denaturing. Causes:
    • Changes in temperature
    • Changes in pH

Denaturing

proteome the set of all of the proteins an organism makes
Proteome: The set of all of the proteins an organism makes.

DNA in 23 chromosomes

Transcribed into mRNA

Genome

Translated into an amino acid sequence by ribosomes

Proteome

Folds into proteins

Polypeptide

Every individual has its own unique genome which leads to its own unique proteome

slide16
Proteins do everything! Such as…

Motor Proteins: They move, allowing cells to change shape. Muscle cells are packed with these.

slide17
Proteins do everything! Such as…

Transport Proteins: These are proteins stuck in the cell membrane that let specific substances in or out of your cells.

slide18
Proteins do everything! Such as…

Receptor Proteins: These are proteins stuck in the cell membrane that are used for cells to communicate with eachother.

slide19
Proteins do everything! Such as…
  • Your immune system tells the difference between “self” and “non-self” by these receptors.
slide20
Blood types are an example of receptor proteins .
  • The blood types are: A, B, AB and O
  • Doctors killed a lot of dogs before they figured this one out…
slide24
There are many ways of representing proteins

DNA Helicase

Space-filling model

slide25
There are many ways of representing proteins

DNA Helicase

Model showing -helixes and -sheets.

20 amino acids bonded together in different orders can form all proteins
20 amino acids bonded together in different orders can form all proteins.

What do proteins do?

Everything!

The function of the protein is defined by its shape.

20 amino acids bonded together in different orders can form all proteins1
20 amino acids bonded together in different orders can form all proteins.

Fibrous

Long, insoluble proteins

Parallel polypeptide chains

Cross-linked

Spider Silk

20 amino acids bonded together in different orders can form all proteins2
20 amino acids bonded together in different orders can form all proteins.

Globular

Folded, compact polypeptide chains

Almost spherical shapes

Rubisco

Rhodopsin

Insulin

Immunoglobulin

denaturation
Denaturation

A process that destroys the complex structure of a protein.

  • Heat
  • Strong acids
  • Strong alkalis

New structure = new function

Denaturation of an egg protein

proteomics
Proteomics

DNA in 23 chromosomes

Transcribed into mRNA

Genome

Translated into an amino acid sequence by ribosomes

Proteome

Folds into proteins

Polypeptide

Every individual has its own unique genome which leads to its own unique proteome

slide35
A chemical reaction is shown below.

Name each reactant and product.

What kind of reaction is this?

Where should water be present in the reaction? How many molecules of water?

Review!

Catabolic Hydrolysis Reaction

Monopeptide

(amino acid)

Monopeptide

(amino acid)

Dipeptide

+

H2O

  • Hydrolysis (water is split)
  • It “fills in” each monomer
slide36
A chemical reaction is shown below.

Name each reactant and product.

What kind of reaction is this?

Where should water be present in the reaction? How many molecules of water?

slide37
A chemical reaction is shown below.

Name each reactant and product.

What kind of reaction is this?

Where should water be present in the reaction? How many molecules of water?

Catabolic Hydrolysis Reaction

Monopeptide

(amino acid)

Monopeptide

(amino acid)

Dipeptide

+

H2O

  • Hydrolysis (water is split)
  • It “fills in” each monomer
dna has the recipe to make proteins
DNA has the “recipe” to make proteins.

A gene is a segment of DNA that has the instructions to make a particular protein.

“Hmmm… how many teaspoons of cytosine was I supposed to add?”

slide41
The base pairs on DNA determine the amino acids, and thus the specific shape, that the protein will have.
slide42
For example… we all have genes for hair color. The base pairs on this DNA determines what proteins are in our hair, and thus, what our hair looks like.

Of course, you can always change it later…

what does it mean to be a translator
What does it mean to be a translator?

What does it mean to transcribe something?

transcription and translation is done every time a cell makes a protein
Transcription and translation is done every time a cell makes a protein.

So, almost every cell in your body is doing this all the time!

Above: the structural protein collagen. This poor guy will be making lots of it soon to repair his body.

ancient egypt was well known for its scribes that made copies of documents
Ancient Egypt was well known for its scribes that made copies of documents.

Nowadays we don’t really need them, we have copy machines…

slide49
Transcription is making a copy of the DNA onto mRNA (messenger RNA). The enzyme that makes it is called RNA polymerase.

Some people transcribe their homework all the time.

mrna is a temporary disposable copy of dna it s sent from the nucleus to the ribosome
mRNA is a temporary, disposable copy of DNA. It’s sent from the nucleus to the ribosome.

DNA is permanent. You don’t want to change or mess with it.

RNA is a disposable copy.

if this was a chain of dna what would the mrna strand be
If this was a chain of DNA, what would the mRNA strand be?

C T G A C T T A G A T A

G A C U G A A U C U A U

slide52
What does DNA have the “recipe” to make?

DNA is the recipe to make protein!

what do ribosomes do1
What do ribosomes do?

Ribosomes make proteins!

what are proteins made out of why do they have the shape that they have
What are proteins made out of? Why do they have the shape that they have?

Proteins are made out of amino acids. The different chemical properties of the amino acids cause the chain to fold up in specific ways.

translation mrna goes to the ribosome and it is translated into an amino acid sequence
Translation: mRNA goes to the ribosome, and it is translated into an amino acid sequence.

tRNA (transfer RNA) brings the correct amino acid for every 3 base pairs.

the 3 bases on mrna is called a codon
The 3 bases on mRNA is called a codon.

The 3 bases on tRNA is called an anti-codon.

slide61
A translator puts information from one language into another.

Translation puts the genetic code (AGTC’s) into the code of amino acids.

slide63
The translator

(ribosome and tRNA)

The scribe

(RNA polymerase)

Protein

DNA

mRNA

What do we call this step?

What do we call this step?

Transcription

Translation

convert the dna to mrna then convert the mrna to amino acids
Convert the DNA to mRNAThen, Convert the mRNA to amino acids.

TAT TCA CTA CTG

GCC

CGG

AUA AGU GAU GAC

Isoleucine Serine Aspartic Acid Aspartic Acid

Argenine

What do we call this step?

Transcription

What do we call this step?

Translation

slide67
This is called the central dogma of biology. (That just means that it is a really important idea)
slide68
At the start of every gene is a TATA box. It tells the mRNA polymerase where to start copying.

Actual gene being transcribed

TATA box

DNA strand:

TCCACGACTATACCGACTACTCTACGGGAATATG

GGCUGAUGAGAUGCCCUUAUAC

mRNA strand:

  • mRNA gets a 5’GTP and a poly-A tail to mark the beginning and end. This helps identify it and “protect” it.

Poly-A tail

5’ GTP

PPPG

AAAAAAAAA

slide69
Biology Journal 10/18/2013

Transcription

Translation

Ribosome

tRNA

RNA polymerase

Replication

mRNA

Protein

DNA helicase

DNA polymerase

DNA

Happens in the nucleus

Happens in the cytoplasm / at the ribosomes

Label each molecule (the pictures).

Label the process that makes each molecule (the purple arrows).

List the name of the enzymes / molecules that carry out each process.

Identify the location where each of these molecules / processes are.

slide70
This is called the central dogma of biology. (That just means that it is a really important idea)
ad