1 / 8

Discovering DNA: Watson, Crick, and Franklin's Pioneering Work in Genetics

This document explores the groundbreaking contributions of James Watson, Francis Crick, and Rosalind Franklin to our understanding of DNA's structure. It highlights Franklin's X-ray diffraction photograph that revealed crucial insights into DNA's double helix formation. The text further discusses the importance of mRNA sequences in gene expression and the biochemical principles behind DNA melting temperatures and hybridization. Through historical context and scientific analysis, this piece showcases the interplay of different researchers in the field of genetics.

rey
Download Presentation

Discovering DNA: Watson, Crick, and Franklin's Pioneering Work in Genetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Figure 16.1 and 6 James Watson and Francis Crick Rosalind Franklin and her X-ray diffraction photo of DNA.

  2. >gi|14456711|ref|NM_000558.3| Homo sapiens hemoglobin, alpha 1 (HBA1), mRNA ACTCTTCTGGTCCCCACAGACTCAGAGAGAACCCACCATGGTGCTGTCTCCTGCCGACAAGACCAACGTCAAGGCCGCCTGGGGTAAGGTCGGCGCGCACGCTGGCGAGTATGGTGCGGAGGCCCTGGAGAGGATGTTCCTGTCCTTCCCCACCACCAAGACCTACTTCCCGCACTTCGACCTGAGCCACGGCTCTGCCCAGGTTAAGGGCCACGGCAAGAAGGTGGCCGACGCGCTGACCAACGCCGTGGCGCACGTGGACGACATGCCCAACGCGCTGTCCGCCCTGAGCGACCTGCACGCGCACAAGCTTCGGGTGGACCCGGTCAACTTCAAGCTCCTAAGCCACTGCCTGCTGGTGACCCTGGCCGCCCACCTCCCCGCCGAGTTCACCCCTGCGGTGCACGCCTCCCTGGACAAGTTCCTGGCTTCTGTGAGCACCGTGCTGACCTCCAAATACCGTTAAGCTGGAGCCTCGGTGGCCATGCTTCTTGCCCCTTGGGCCTCCCCCCAGCCCCTCCTCCCCTTCCTGCACCCGTACCCCCGTGGTCTTTGAATAA AGTCTGAGTGGGCGGC LE 16-5 http://www.ncbi.nlm.nih.gov/

  3. (a) Space-fillingmodel Key features ofDNA structure (c) 5 end G C Hydrogen bond C G 3 end C G C A T G 3.4 nm Figure 16.7 A T C G C G C G A T 1 nm G C T A C G C G T A G C 3 end A T A T 0.34 nm 5 end A T (b) Partial chemical structure

  4. Sugar Figure 16.8 Sugar Adenine (A) Thymine (T) Sugar Sugar Guanine (G) Cytosine (C)

  5. Figure 16.UN04

  6. Purine  purine: too wide Figure 16.UN01 Pyrimidine  pyrimidine: too narrow Purine  pyrimidine: widthconsistent with X-ray data

  7. Stability of DNA: example of a DNA melting curve. UV absorbance spectra of native and heat-denatured E. coli DNA. Voet, Fundamentals, 2nd

  8. Variation of the melting temperatures, Tm, of various DNAs with their G + C content. Relevance for DNA melting and hybridization PCR (polymerase chain reaction) DNA microarrays (gene expression) Helicases, polymerases (transcription, duplication) Chargaff’s rule shows correlation between Tm and G+C content Voet and Voet, Biochemistry, chapter 5

More Related