slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
Operator Promoter PowerPoint Presentation
Download Presentation
Operator Promoter

Operator Promoter

70 Views Download Presentation
Download Presentation

Operator Promoter

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. Multiple Cloning Region Operator Promoter

  2. Nobel Prize – 1958 – Developed method to sequence proteins (insulin) Dr. Fred Sanger Nobel Prize – 1980 – Developed method to sequence DNA (bacteriophage, human mitochondria)

  3. OH Dideoxynucleoside triphosphate (ddNTP) Deoxynucleoside triphosphate (ddNTP)

  4. Radioactivity X-ray

  5. T7 Primer = TAATACGACTCACTATAGGG SP6 Primer = GATTTAGGTGACACTATAG Multiple Cloning Region Operator Promoter

  6. Sequence from an unknown piece of DNA. A single sequencing reaction was loaded into four lanes, allowed to run for a couple hours (right set of 4 lanes; called the long run) and then more of the same reaction was loaded and run for another two hours (left set of 4 lanes; called the short run).

  7. This means that someone has to “read” all of these gels

  8. Human Genome Project First discussed at a Dept. of Energy meeting (1984) on the effects of radiation on U.S. populations 1988 = Congress authorized Dept. of Energy & Nat. Institute of Health to use $3 billion over a 15-year period 1990 = it started…predicted to be finished in 2005 At a cost of $3 billion (about $1 per base)

  9. “Rough map of human genome completed” • Milestone in genetics expected to be giant boon for medicine • June 26, 2000 How did it get done 5 years early? Dr. Francis Collins Nat. Institute of Health Dr. J. Craig Venter CEO, Celera Genomics Corp. ……

  10. …and now there is “Multichannel” so can do 8 at once Capillary Gel Electrophoresis …allowed people to bypass having to do slab-gel electrophoresis

  11. Rooms full of sequencers

  12. …and robotics….


  14. Dr. J. Craig Venter originally worked for the government on the project, but disagreed how it should work. He wanted to use the “shotgun method”…chopping the entire genome into small pieces, sequencing them, and then fitting them together like pieces of a puzzle. He also integrated Capillary Gel Electrophoresis and the use of robotics and computers. He quit, and got the financial backing to found Celera Genomics Corp. The idea was to “scoop” the feds and sequence the genome on their own. This raised lots of questions about the marketability of the human genome sequence.


  16. TTTTTGGGTA GGGTACACATAGCT TAGCTCTCGAGAGG GAGGCTCTCTCTCT TTTTTGGGTACACATAGCTCTCGAGAGGCTCTCTCTCT This method uses Genomic Libraries made with different restriction enzymes. They just used regular sequencing primers (like T7 and SP6). Shotgun Method is heavily dependent on computers!

  17. Ventner also sequenced human cDNAs (mRNA). This meant that they could really focus on the parts of the Genome that actually encode gene product rather methodically Primer-walking through the genome!

  18. The part of the genome that took longer to complete were the parts with lots of repetitive sequences: TTAGGGTTAGGG TTAGGGTTAGGG TTTTTTATTTTTT TTAGGCAGCAGCAGCATTTTCTTTT It was totally completed in 2003

  19. Genomes that are 100% completed: • Prokaryotes = 302 • Fungi = 9 • Protists = 3 • Plants = 2 (Arabidopsis, rice) • Animals = 4 (fruitfly, nematode, mouse, human) • 272 more genomes published as “drafts” • 505 other genomes “in progress” • = 1097 genome projects in all

  20. Celera’s stock dropped the day of the joint announcement about finishing the genome project. Celera is hoping to make money by leasing genome analysis software and on patents on genes of other species like bacteria, fruitfly, dogs, etc.