微生物遺傳與生物技術 (Microbial Genetics and Biotechnology)

1. 微生物遺傳與生物技術(Microbial Genetics and Biotechnology) 金門大學 食品科學系 何國傑 教授

2. Autonomously replicating genetic entities (1) the plasmid and bacterial conjugation

3. I. What is a plasmid? 1. In addition to chromosome, bacteria cells often contain other DNA molecules called plasmids. It is an extrachromosomal DNA which can replicate independent of chromosome. 2. Naming plasmid (1) previously plasmids are named by the gene function they carry, for example, R-factor plasmids contain genes for resistance to several antibiotics. (2) The naming of plasmids is now standardized: A small ‘p’ for plasmid, precedes letters that describe the plasmid or sometimes give the initials of the person or persons who isolated or constructed it. These letters are often followed by numbers to identify the particular construct. For example, pBR322 was constructed by Bolivar and Rodriguez, and 322 of the plasmid they constructed. 3. Functions encoded by plasmids (1) Unlike chromosomes, plasmids generally do not encode functions essential to bacterial growth. Instead, plasmid genes usually give bacteria a selective advantage under only some condition.

4. I. What is a plasmid? (2) Why many nonessential functions are encoded on plasmid and not on chromosome? 4. Plasmid structure (1) Most plasmids are circular with no free ends, although a few known plasmids are linear. (2) Plasmid DNA can be supercoiled because it is a covalently closed circular, and are usually negatively supercoiled (3) The negative supercoiling introduces stress and this stress is partially relieved by the plasmid wrapping up on itself. In the cell, the DNA wraps around proteins, which relieves some of the stress. The remaining stress facilitates some reactions involving the plasmid, such as separation of the two DNA strands for replication or transcription. 5. Properties of plasmids (1) replication – A plasimid is a replicon that can replicate autonomously in the cell. Plasmid encodes only a few of the proteins required for their own replication.

5. Supercoiling of a covalently closed circular plasmid

6. Less EtBr can bind to a covalently closed circular DNA than to a linear or nicked circular DNA

7. Separation ofcovalently closed circular plasmid DNA from linear or nicked circular DNAs on EtBr-CsCl gradient

8. I. What is a plasmid? 2. Each type of plasmid replicates by one of two general mechanisms: i. Theta (θ) replication – In this process, two strands of DNA are opened at ori and an RNA primer begins replication, which can proceed in one or both direction(s). ii. Rolling-circle replication: (i) A Rep protein recognizes and binds to a palindromic sequence which contains the double-strand origin (DSO) on the DNA. (ii) Rep protein mightallow the formation of a cruciform structure by base pairing between the inverted repeated sequences. (iii) Rep protein makes a nick and remains covalently attached to the phosphate at 5’ end of DNA through a tyrosine in one copy of the dimmer Rep. (iv) The DNA polymerase III uses the free 3’ OH end at the break as a primer to replicate around the circle, displacing one of the strand.

9. Uni- and bi- directional replication A. Unidirectional replication: Replication terminates when the replication fork gets back to the origin. B. Bidirectional replication: Replication terminates when the replication forks meet somewhere on the DNA molecule opposite the origin.

10. Rolling-circle replication

11. Rolling-circle replication 1. A nick is made at the double-stranded origin (DSO) by plasmid- encoded Rep protein, which remains bound to the 5’ phosphate end. 2. The free 3’ end serves as a primer for Pol III that replicate around the circle, displacing one of the old strands as a single-stranded DNA. 3. Rep make another nick, releasing the single-stranded circle, and also joins the ends of new DNA to form a circle by phosphotransferase reaction. 4. The DNA ligase joins the ends of the new DNA to form a double- stranded circle. 5. The host RNA polymerase makes a primer on the single-stranded DNA origin (SSO), and Pol III replicates the single-stranded (SS) DNA to make another double-stranded circle. 6. DNA pol I removes nthe primer, replacing it with DNA, and ligase joins the ends to make another double-stranded DNA 7. CCC DNA: covalently closed circular; SSB: single-stranded-DNA- binding protein

12. (3) Replication of linear plasmids i. Linear DNA replication faces a problem with replicating the lagging strand. There is no upstream primer on this strand from which to grow. Different linear DNAs solve the primer problem in different ways. ii. Some linear plasmids have hairpin ends, which means that the 3’ end is attached to the 5’ end on the other antiparallel strand. The plasmid replicates from an internal origin of replication to form dimeric circles, composed of two plasmids joined head to tail to form a circle. These dimeric circles are then resolved into individual linear plasmid DNA by prototelomerases. iii. Some linear plasmids have extensive inverted repeated sequences at their ends and a terminal protein attached to the 5’ ends. They might use some sort of slippage mechanism, using the terminal protein as either a recombinase or a primer or both.

13. (4) Functions of the ori region In most plasmids, the genes for proteins required for replication are located very close to the ori sequences at which they act. The genes in the ori region often determine many other properties of the plasmid. Therefore any DNA molecule with the ori region of a particular plasmid will have most of the characteristics of that plasmid, such as i. Host range – Some plasmids, such as those with ori regions of ColE1 plasmid type have a narrow host range. Other plasmids have a broad host range. These plasmids of broad host range must encode all of their own proteins required for initiation of replication and so do not have to depend on the host cell for any of these functions. ii. Copy number – Plasmids that have high copy numbers, called relaxed plasmids, such as ColE1 plasmids need only have a mechanism that inhibits the initiation of plasmid replication when the number of the plasmids in the cell reaches a certain level. Low-copy-number plasmids, called stringent plasmids, such as F plasmids must have a tighter mechanism for regulating their replication.

14. Incompatibility iii. Incompatibility – refers to the ability of two plasmids to coexist stably in the same cell. If two plasmids can not coexist stably, they are said to be members of the same incompatibility (Inc) group. If they can coexist stably, they belong to different Inc groups. iv. There are a number of ways in which plasmids can be incompatible: (i) Due to shared replication control – Each plasmid regulate the other’s replication. (ii) Due to partitioning – Two plasmids share the same Par (partition) system.

15. Coexistence of two plasmids from different Inc groups B. Curing of cells of one of two plasmids when they are members of the same Inc group. The sum of the two plasmids will equal the copy number, but one may be underrepresented and lost in the subsequent divisions. Eventually, most of the cells will contain only one or the other plasmid. A. Coexistence of two plasmids of different Inc groups. After division, both plasmids will replicate to reach their copy number.

16. (5) Control mechanisms of plasmid replication (5) (using ColE1-derive plasmid as an example) i. Replication is regulated mostly through a small plasmid- encoded RNA I which interferes with the processing of RNA II ii. RNA II is cleaved by the RNA endonuclease RNase H, releasing a 3’ hydroxyl group that serves as the primer for replication first catalyzed by DNA polymerase I. iii. RNA I can form a double-stranded RNA with RNA II because they are transcribed from opposite strands in the same region of DNA. Initially, the pairing between RNA I and II occurs through short exposed regions on the two RNAs that are not occluded by being part of secondary structure. This initial pairing is very weak and has been called “kissing complex”. Rop protein (sometimes called Rom) is known to help the formation of kissing complex. Mutations that inactivate Rop cause only a moderate increase in plasmid copy number.

17. Control mechanisms of plasmid replication iv. Formation of the double-stranded RNA prevents the RNA II from forming the secondary structure required for it to hybridize to the DNA before being processed by RNase H to form the mature primer. v. RNA I is synthesized from the plasmid, more RNA I is made when the concentration of the plasmid is high (up to 16 copies) and will interfere with processing of most of the RNA II. This mechanism provides an explanation for how the copy number of ColE1 plasmids is maintained. vi. A single-base-pair mutation in the RNA I coding region of plasmid will effectively change the Inc group of plasmid to form a new Inc group.

18. Control mechanisms of plasmid replication vii. The ColE1-derived plasmids are unusual in that they do not required the plasmid encoded protein, Rep to initiate DNA replication at their oriV region, only an RNA primer synthesized from plasmid. The Rep protein is required to separate the DNA strands of DNA at the oriV region, often with the help of host proteins including DnaA. The copy number of some plasmids can be controlled, at least partial, by controlling the synthesis of the Rep protein, such as R1 plasmid.

19. Pairing between an RNA and its antisense RNA

20. Regulation of replication of IncFII plasmid R1 B. Immediately after the plasmid enters the cell, most of the repA mRNA is made from promoter PrepA until the plasmid reaches its copy number. C. Once the plasmid reaches its copy number, CopB protein represses transcription from PrepA. Now, repA is transcribed only from PcopB. C’ The antisense RNA CopA hybridizes to the leader peptide coding sequence in the repA mRNA, and the double-stranded RNA is cleaved by RNase III. This prevents translation of RepA, which is translationally coupled to translation of the leader peptide. A. The locations of promoters and genes, and gene products involved in regulation.

21. Iteron plasmids • The plasmids whose oriV region contains several repeats of a certain set of DNA bases called iteron sequence, such as pSC101, F.

22. The ori region of pSC101, R1, R2, and R3 are the three iteron sequence (CAAGGTCTAGCAGCAGAATTTACAGA for R3) to which RepA binds to handcuff two plasmids. RepA autoregulates its own synthesis by binding to the inverted repeats IR1 and IR2.

23. The “handcuffing” or “coupling” model for regulation of interon plasmids Left: At low concentrations of plasmids, the RepA binds to only one plasmid at a time, initiating replication. Right: At high plasmid and RepA concentrations, the RepA may dimerize and bind to two plasmids simultaneously, handcuffing them and inhibiting replication.

24. Molecular genetic analysis for the regulation of interon plasmids B. Additional iteron sequences in an unrelated plasmid can cower the copy number of an iteron plasmid. A. The RepA protein is expressed from a clone of the RepA gene in an unrelated cloning plasmid vector.

25. 6. Mechanism to prevent curing of plasmids Cells that have lost a plasmid during cell division are said to be cured of the plasmid. Several mechanisms prevent curing, including plasmid addition systems, site-specific recombination and partitioning systems. i. Resolution of multimeric plasmids – (i) A possibility that a cell will lose a plasmid during cell division is increased if the plasmids form dimmers or multimers during replication due to segregating into only one daughter cell. because of with more than one par site. (ii) Dimers or multimers can occur as a recombination between monomers or the termination of rolling-circle replication after each round of replication is not efficient. (iii) Multimers may replicate more efficiently than monomers, perhaps because they have more than one origin of replication. (iv) To avoid the problem, many plasmids have site-specific recombination systems that resolve multimers as soon as they form. The recombination occurs between the specific sites on the plasmid.

26. 6. Mechanism to prevent curing of plasmids ii. The most effective mechanism that plasmids have to avoid being lost from dividing cells is their set of partitioning systems. The following is the example of R 1 plasmid: (i) The partitioning system of R 1 plasmid consists of two protein-coding genes, parM and parR , as well as a centromere-like cis-actin site, parC. (ii) Protein ParM can bind to ParR only a few dimmers of ParR protein bound to parC site. The ParR-parC complex serves as a sort of nucleation site for the assembly of ParM. (iii) While plasmid is replicating, this complex of the two ParM and ParR proteins is localized to the midpoint of the cell and thereby localizes plasmid to this point. (iv) When replication is completed, the ParM protein, in ParM- ATP form begins to polymerize into helical filaments that extend from the center of the cell toward the cell pole by the addition of ParM subunits to the end. (v) After the plasmid copies have been pushed to the ends, the ParM-ADP dissociate and the filaments disappear.

27. Partioning of the R1 plasmid