620 likes | 783 Views
Honors Biology Chapter 12 Molecular Genetics. Identify key historical findings in the pursuit of the structure of DNA.
E N D
Honors BiologyChapter 12 Molecular Genetics
Identify key historical findings in the pursuit of the structure of DNA. Draw and label a diagram of the molecular structure of DNA, showing the relationships between the six essential molecules that make up DNA: deoxyribose, phosphate, adenine, cytosine, guanine, thymine. Apply knowledge of complementary base pairing to predict a DNA strand sequence given information about the other DNA strand.
What IS the physical “factor” identified by Mendel? • How do “factors” produce phenotypes? What is the molecular basis for the “genetic code?” • Scientists could narrow it down to molecules found in the nucleus: DNA, RNA, or protein? • Most thought proteins, because they’re much more diverse and complex
Griffith’s Transformation • Working with pneumonia in 1928, Griffith transformed or changed bacteria from one form to another.
Avery’s Experiments • What is the “transforming factor”? • Avery used enzymes to destroy molecules from the heat killed cells before transforming harmless cells. • Concluded: DNA is the transforming factor.
Hershey-Chase Experiment • Alfred Hershey & Martha Chase: Radioactively label viral protein vs. DNA, let the phages infect bacteria, then separate them • Bacteria had the DNA trace, not the protein trace
Rosalind Franklin & Photo 51 • Franklin used X-ray diffraction to photograph crystallized DNA molecules. • Showed the helical shape and repeating structure of DNA
The Double Helix • In 1953, James Watson and Francis Crick used scientific evidence reported by other scientists to suggest a model for the DNA structure as a double helix
Nucleic Acids Examples • DNA • Deoxyribonucleic Acid • RNA • Ribonucleic Acid Information molecules RNA
proteins DNA Nucleic Acids • Function: • genetic material • stores information • blueprint for building proteins • DNA RNA proteins • transfers information • blueprint for new cells • blueprint for next generation
sugar N base phosphate Nucleic acids • Building block = nucleotides nucleotide – nucleotide – nucleotide – nucleotide • 5 different nucleotides • different nitrogen bases • A, T, C, G, U Nitrogen basesI’m the A,T,C,G or Upart!
4 Types of Nitrogenous Bases in DNA • Purines: have 2 rings (Adenine and Guanine) • Pyrimidines: have 1 ring (Thymine and Cytosine)
Complementary Base Pairing • Chargaff’s Base Pairing Rule: Chargaff determined that the amount of Adenine = amount of Thymine, and the amount of Guanine = the amount of Cytosine. • The bases are connected to each other in the double helix by hydrogen bonds. • A pairs with T • C pairs with G
DNA • Double strand twists into a double helix • Hydrogen bonds between nitrogen bases that join the 2 strands are weak • the two strands can separate and reattach with relative ease
Describe and model the process of DNA replication, including an explanation of why it produces identical copies of DNA.
Copying DNA • A dividing cell replicates (i.e. duplicates) its DNAin S phase • creates 2 copies of all DNA (sister chromatids) • separates the 2 copies to 2 daughter cells DNA cell nucleus
Copying DNA • Matching bases allows DNA to be easily copied
DNA Replication • Steps: • DNA starts as a double-stranded molecule • matching bases (A:T, C:G) • Then the helix untwists and…
DNA replication • Strands “unzip” at the weak bonds between bases • Done by an enzyme, helicase
DNA replication • Enzyme DNA polymerase • matches free-floating bases to exposed strand DNA basesin nucleus DNA polymerase
DNA polymerase DNA polymerase New copies of DNA • Get 2 exact copies of DNA to split between new cells, thanks to complementary base pairing • Each copy = one original strand, one new strand
Copying DNA DNA Replication-Review • This process is responsible for the formation of sister chromatids, and their characteristic X shape
double-strandedhuman chromosomes ready for mitosis
Compare and contrast DNA and RNA. Explain and model the overall process of protein synthesis (transcription and translation). Apply knowledge of transcription to predict an mRNA sequence given information about a DNA sequence.
DNA Proteins Cells Bodies proteins cells bodies DNA gets all the glory,Proteins do all the work
What do we know? • DNA • DNA = instructions for proteins • Proteins • proteins run living organisms • enzymes • all chemical reactions in living organisms are controlled by enzymes (proteins) • structure • all living organisms are built out of proteins
Protein Synthesis: Part 1 CELL CYTOPLASM So… How does the cell get the instructions from the nucleus to the ribosomes? NUCLEUS RIBOSOMES – where proteins are made DNA – stores info to make proteins mRNA Where are the instructions to make proteins? Where are proteins made? It makes a copy to send called – messenger RNA
Flow of Genetic Information • 1. A gene or segment of DNA is located on a chromosome • 2. The cell uses transcription to copy the gene into a piece of mRNA • 3. The mRNA leaves the nucleus and goes to a ribosome • 4. The ribosome uses translation to direct the assembly of a protein • 5. Gene is now expressed in the cell
RNA = Ribonucleic Acid • Structure: • Made of a single strand of nucleotides • Nucleotides use Ribose instead of Deoxyribose • Nitrogen base thymine is replaced by Uracil • Types: • Messenger RNA (mRNA): single stranded- used to carry DNA code out of nucleus “working copy” • Transfer RNA (tRNA): binds to specific amino acids, used to build proteins • Ribosomal RNA (rRNA): makes up ribosomes along with proteins
DNA deoxyribose sugar nitrogen bases G, C, A, T T = thymine T : A C : G double stranded RNA ribose sugar nitrogen bases G, C, A, U U = uracil U : A C : G single stranded DNA vs. RNA
DNA vs. RNA DNA RNA DNA
Transcription • Making mRNA from DNA • DNA strand is the template (pattern) • match bases • U : A • G : C • Enzyme • RNA polymerase
Matching bases of DNA & RNA • Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T
Matching bases of DNA & RNA • Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T
RNA polymerase Matching bases of DNA & RNA A • Match RNA bases to DNA bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U A G C C A T G G T A C A G C T A G T C A T C G T A C C G T
Matching bases of DNA & RNA • U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA
Transcription Steps • RNA Polymerase binds to the promoter (specific place for polymerase to bind) on the DNA and begins transcription • DNA strands separate or unzip. • One of the original strands serves as a template. RNA polymerase binds new RNA nucleotides to the template strand following base pairing rules. (A-U, C-G) • mRNA leaves the nucleus and carries the instructions to the ribosomes. The DNA “re-zips”. A – T C – G G – C A – T C – G T – A A - - T C - - G G - - C A - - T C - - G T - - A A - U - T C - G - G G - C - C A - U - T C - G - G T - A - A A – T U C – G G G – C C A – T U C – G G T – A A 1 2 3 - 4 5
Explain and model the overall process of protein synthesis (transcription and translation). Apply knowledge of translation to predict a tRNA sequence given information about an mRNA sequence. Apply knowledge of translation to predict an amino acid sequence given information about a tRNA sequence.
RNA to protein • But… building blocks are mismatched. • RNA “language” = 4 bases. Protein “language” = 20 amino acids. How do you convert from one language to another? mRNA A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa aa aa aa aa aa
TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? But there’s still the 4 to 20 problem…
TACGCACATTTACGTACGCGG DNA codons AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? Solution: mRNA codes for proteins in triplets • Codon • block of 3 mRNA nucleotides that “codes” for one amino acid
UAC GCA CAU Met Arg Val Now, how are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon tRNA anti-codon aminoacid
U A C tRNA tRNA A G U A G aa aa tRNA aa mRNA to protein = Translation • The message -> mRNA • The reader ribosome • The transporter transfer RNA (tRNA) • The product -> polypeptide/protein ribosome mRNA A C C A U G U C G A U C A G U A G C A U G G C A U G G aa C tRNA aa aa
Transfer RNA • Transfer RNA (tRNA) • A folded RNA chain, with three exposed bases (anticodon) and an amino acid • Which amino acid it carries depends solely on the anticodon • Function: Carry amino acids to ribosome, assemble them in correct order
Translation Steps • Initiation: Ribosome attaches to the mRNA at the start codon (AUG) • tRNA with the complementary anti-codon (UAC) binds to the mRNA codon, bringing the amino acid methionine with it. • Ribosome shifts down the mRNA to the next codon. • Elongation: Another tRNA with the complementary anti-codon binds to the mRNA codon. The amino acid from the tRNA binds to methionine. • The ribosome shifts again, another tRNA brings another amino acid to bind to the growing amino acid chain. • Termination: Process continues until the ribosome reads a stop codon, at which time it releases the finished amino acid chain (AKA: protein)
In Animated Format • http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html • http://learn.genetics.utah.edu/content/begin/dna/transcribe/ • http://www.dnatube.com/video/5934/Basic-explanation-of-mRNA-Translation • http://highered.mcgraw-hill.com/sites/0072507470/student_view0/chapter3/animation__protein_synthesis__quiz_3_.html
Genetic Code • All life on Earth uses the same code • Due to common origin • Code is redundant • several codons for each amino acid • “mutation insurance!” • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG
The Genetic Code • A map of CODONS, not ANTIcodons
Recap of Protein Synthesis • A gene = a region of the chromosome that codes for one protein • mRNA is made in the nucleus using DNA as a template. (TRANSCRIPTION) mRNA travels to ribosome. • Protein is made at the ribosome by matching tRNA to mRNA. (TRANSLATION) • Amino acid sequence determines protein’s shape, protein shape determines its function.