1 / 35

Understanding DNA Technology and Genetic Engineering

This chapter delves into DNA technology and the realm of genetic engineering, which allows the manipulation of DNA for various applications, ranging from treating genetic diseases to enhancing food crops. Key processes discussed include the isolation of DNA, cutting with restriction enzymes, and cloning using vectors. It also highlights the significance of polymerase chain reaction (PCR) and gel electrophoresis in DNA analysis. Through these techniques, scientists aim to improve human health and agriculture, ultimately enhancing the quality of life.

platt
Download Presentation

Understanding DNA Technology and Genetic Engineering

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 13: DNA Technology

  2. With all our knowledge of DNA and genes, is there any way to manipulate DNA? • Genetic Engineering – form of applied genetics in which genes/DNA are manipulated Ex. Genetic engineers believe they can improve the foods we eat. Tomatoes are sensitive to frost. This shortens their growing season. Fish, on the other hand, survive in very cold water. Scientists identified a particular gene which enables a flounder to resist cold and used the technology of genetic engineering to insert this 'anti-freeze' gene into a tomato.

  3. DNA Technology Science involved in the ability to manipulate genes/DNA Purpose: • Treat genetic diseases (cystic fibrosis, hemophilia) • Diagnose genetic disorders • Improve food crops (better tasting veggies, longer shelf life, fungus resistance) • Improve human life in general (vaccines…)

  4. How is it all done? Recombinant DNA Technology Steps in the process:                     -I. Isolation of DNA and copying                    -II. Cutting – with restriction enzymes                    -III. Sorting by size                    -IV.Cloning into vectors                     -V. Probes - identification

  5. I. Isolate DNA and copy • Remove tissue from organism • DNA extraction lab • Store at 4°C

  6. PCR – Polymerase Chain ReactionA genetic copy machine • The polymerase chain reaction (PCR) is a rapid way of amplifying (duplicating) specific DNA sequences from a small sample of DNA.

  7. II. Cutting DNA • Restriction enzymes – • Enzymes that can cut (hydrolyze) DNA at specific sites. • Current DNA technology is totally dependent on restriction enzymes. • Restriction enzymes are endonucleases – they cut within the DNA • Molecular scissors

  8. What are restriction enzymes? • Bacterial enzymes – used to cut bacteriophage DNA (viruses that invade bacteria) – why? • Different bacterial strains produce different restriction enzymes • The names of restriction enzymes are derived from the name of the bacterial strain they are isolated from • Cut (hydrolyze) DNA into defined and REPRODUCIBLE fragments • Basic tools of gene cloning

  9. Names of restriction endonucleases • Titles of restriction enzymes are derived from the first letter of the genus + the first two letters of the species of organism from which they were isolated. • EcoRI -  from Escherichia coli • BamHI - from Bacillus amyloliquefaciens • HindIII - from Haemophilus influenzae • PstI -  from Providencia stuartii • Sau3AI - from Staphylococcus aureus • AvaI -  from Anabaena variabilis

  10. Restriction enzymes recognize a specific short nucleotide sequence • For example, EcoRI recognizes the sequence • 5‘- G/ A A T T C -3' • 3'- C T T A A /G -5'

  11. Examples of restriction enzymes and the sequences they cleave • Palindromes – same base pairing forward and backwards

  12. Let’s try some cutting: • Using this piece of DNA, cut it with Eco RI • G/AATTC • GACCGAATTCAGTTAATTCGAATTC • CTGGCTTAAGTCAATTAAGCTTAAG • GACCG/AATTCAGTTAATTCG/AATTC • CTGGCTTAA/GTCAATTAAGCTTAA/G

  13. What results is: • GACCG AATTCAGTTAATTCG AATTC • CTGGCTTAA GTCAATTAAGCTTAA G Sticky end - tails of DNA – easily bindto other DNA strands Sticky end

  14. Blunt & Sticky ends • Sticky ends – Creates an overhang. BamH1 • Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends

  15. Sorting: Gel Electrophoresis DNA fingerprinting – • Banding pattern of the fragments of cut DNA on a special gel medium (agarose)

  16. Purpose for DNA fingerprinting • Comparing banding patterns to determine hereditary relationships between people • Comparing banding patterns of two different species to determine evolutionary relationship • Compare samples of blood or tissue for forensic purposes (who done it?)

  17. How is it done? • RFLP analysis – Restriction fragment length polymorphism, a technique that analyzes VNTRs. We each have non-coding segments on our DNA. • Variable number tandem repeats = CACACA = variations in DNA length found in non-coding DNA

  18. Gel Electrophoresis • Extract DNA sample from blood or tissues • Cut DNA using restriction enzymes. Fragment lengths varies with each person • Separate fragments by gel electrophoresis– separates DNA fragments by the # of base pairs (length of the fragment) and charge 4. Place DNA sample into wells in the agarose gel – molecular sieve 5. Run a current through the gel. The DNA (negatively charged) will migrate from (-) to (+) • The larger fragments will not migrate that far. The small fragments will go the furthest. 7. Stain gel and bands in a dye or use a radioactive probe to analyze the banding

  19. Very accurate method of analyzing DNA; does not work with identical twins

  20. Another thing you can do with DNA… • IV. Cloning vectors • Transfer of isolated gene to another organism with the purpose of having the organism transfer the gene. • Use bacterial plasmids and restriction enzymes

  21. The same restriction enzyme used to cut the desired gene is used to splice the plasmid • Donor gene (desired gene) is then spliced or annealed into the plasmid • Plasmid is then returned to bacterium and reproduces with donor gene in it. • Bacterium with donor gene can transfer donor genes to organisms it infects.

  22. How this works to help humans Diabetes, for example: • Isolate insulin gene from a healthy human • Using a restriction enzyme, cut out insulin producing gene • Cut bacterial plasmids with same restriction enzyme • Introduce human insulin producing gene to bacterial plasmid • Bacterial plasmid takes up gene - recombinant DNA • Bacterial plasmid reproduces and starts expressing insulin • Insulin is produced and harvested from bacteria

  23. What has been produced is Recombinant DNA - DNA with genes from other organisms • Transgenic organisms have introduced DNA from another species in them and are the result of recombinant DNA technology

  24. Practical Use of DNA technology • Pharmaceutical products – insulin, HBCF (human blood clotting factor) • Genetically engineered vaccines – to combat viral infections (pathogenic – disease causing) – your body recognizes foreign proteins, produces antibodies. Introduced viral proteins will trigger an immune response and the production of antibodies • Altering viral genomes – makes them no longer pathogenic – now a vaccine • Not such a great idea

  25. Increasing agricultural yields – • New strains of plants – GMO – Genetically Modified organism. Try this one!! • Insect resistant plants – Insert gene that digests larvae when larvae try to eat the plant – Not always specific to harmful species!! – Monarch problem • Disease resistance – Fungal resistance in tomatoes, corn, soybean • Herbicide resistance - *Round Up won’t harm the good plants, only the bad plants (weeds) – cheaper and less labor extensive than weeding • Getting genes from Nitrogen fixing bacteria inserted into plants – fix their own nitrogen (a must for plants) in N poor soils • Salt tolerant plants – can grow plants where high concentrations of salt in the air or soil

  26. http://en.wikipedia.org/wiki/Genetically_modified_food • Improve quality of produce - Slow down the ripening process – ship when unripened, to market when ripe - Enhance color of produce - Reduce hairs or fuzz on produce - Increase flavor

  27. Why GM Foods?

  28. Safety and Environmental Issues • All food products are regulated by the: Food and Drug Administration – FDA • Nat’l Institutes of Health Recombinant DNA Advisory Committee and the Department of Agriculture (USDA) • Environmental Protection Agency (EPA) • All set standards for safety procedures and require permits and labeling (not in US though). Look for a 8 before the product code. 84011 – GMO banana • Problem with transgenic foods is that an introduced gene may produce a protein that someone may be sensitive to; FDA does not require that on a label

  29. Gene Therapy • Treatment of a genetic disorder (like cystic fibrosis) by correcting a defective gene that causes a deficiency of an enzyme • Nasal spray that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary • Has not been proven to be successful in the long term

  30. Hello Dolly!

More Related