peers
Uploaded by
20 SLIDES
321 VIEWS
200LIKES

Unraveling Protein Synthesis: From DNA to Polypeptides

DESCRIPTION

This overview dives into the intricate process of protein synthesis, where DNA encodes for proteins through two critical phases: transcription and translation. In the nucleus, transcription converts DNA into a messenger RNA (mRNA) strand, which carries the genetic blueprint. This mRNA then travels to the cytoplasm, where ribosomes "read" the mRNA in codons, signaling transfer RNA (tRNA) to bring specific amino acids. These amino acids are linked together to form polypeptides, determining the protein's structure and function. Understand the DNA-to-protein journey and its significance in biochemistry!

1 / 20

Download Presentation

Unraveling Protein Synthesis: From DNA to Polypeptides

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Protein Synthesis DNA’s destiny!

  2. Protein Review POLYPEPTIDE MADE OF MANY AMINO ACIDS • Long chains (POLYPEPTIDES) formed by 20 different amino acids • Protein shape is determined by DNA sequence! SO HOW DO WE GO FROM DNA TO PROTEIN??

  3. What does DNA really do? • The genes in DNA must code for something right??? So what IS IT???? • The DNA alphabet (A, T, C, G) essentially codes for amino acids • Which are the building blocks for……. PROTEINS!!!!!!!!!!

  4. What does DNA do?? Con’t…… • The order of bases in DNA contains a code for a SPECIFIC order of amino acids • The order of amino acids determines the shape and function of the protein

  5. DNA to Protein overview DNA TAKES PLACE IN NUCLEUS mRNA Ribosome “reads” mRNA TAKES PLACE IN CYTOPLASM tRNA brings proper AMINO ACIDS to ribosome as mRNA is read Amino acids are linked together to make PROTEIN that gene coded for

  6. DNA to Protein Overview: The 2 phases • PHASE 1: In the NUCLEUS • Called TRANSCRIPTION • “Transcribing” DNA to single strand of mRNA • This creates a “readable” message for ribosomes • PHASE 2: In the CYTOPLASM • Called TRANSLATION • Ribosomes “translate” the message found on the mRNA strand into amino acids • The amino acids are strung together to make the protein the gene coded for

  7. DNA to PROTEIN http://www.youtube.com/watch?v=983lhh20rGY

  8. RNA Basics • RNA is single stranded • Contains U (uracil)instead of T (thymine) • So A binds with U in RNA • Types of RNA: • mRNA • Messenger RNA • Result of transcription • Contains a message from DNA • tRNA • Transfer RNA • Brings proper amino acid to ribosome during translation

  9. Phase 1: Transcription- Making mRNA Occurs INSIDE THE NUCLEUS • DNA strands separate at the bases • ComplimentaryRNA bases take their places along one of the DNA strands with the help of enzymes • Remember…..RNA bases are A, C, G, and U (uracil) • U instead of T! • This creates an mRNA strand Let’s see this in action!

  10. Phase 1: Transcription con’t… DNA Strands mRNA Strand mRNA is constructed using ONE strand of DNA. mRNA pairs U with A, instead of T. DNA IS UNZIPPED Let’s practice making mRNA from a DNA strand! mRNA leaves nucleus and attaches to a ribosome in the cytoplasm

  11. Diagram of Transcription

  12. Phase 2: Translation- Making a Protein Occurs in the CYTOPLASM at a RIBOSOME • mRNA from transcription leaves the nucleus • mRNAattaches to a ribosome • Ribosome “reads” the message in the mRNA • Ribosomes can only read 3 bases at a time!!! • 3 mRNA bases is called a CODON.

  13. Translation con’t…. • Reading mRNA by ribosome signals a tRNA to bring the correct amino acid • A codon codes for 1 amino acid (LOOK AT YOUR CODON SHEET) • Ex.AUG codes for tRNA to bring Methionine • tRNA drops off amino acid at the ribosome

  14. Translation con’t…. • Ribosome “reads” the next codon to signal for the next amino acid • Amino acids are connected by BONDS as they are brought by tRNA • The last codon read is a STOP codon that means the protein is complete!

  15. Translation Diagram Forming Polypeptide Ribosome mRNA

  16. Close up of translation

  17. Let’s practice Translation! • The strand we made earlier is: • If 3 bases code for 1 amino acid, how many amino acids are coded for in our strand? 3 of course! • Using your CODON SHEET, translate the mRNA codons into 3 amino acids

  18. Translation Example mRNA Strand Ribosome Methionine tRNA brings Peptide Bond Ribosome Asparagine tRNA brings Ribosome Leucine tRNA brings

  19. Let’s do the whole thing together! • DNA strand: TACAAACATGGCTGATCGATT • mRNA strand AUG|UUU|GUA|CCG|ACU|AGC|UAA • Amino Acids MET-PHE-VAL-PRO-THR-SER-STOP

  20. Protein Synthesis Overview

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer