orrick
Uploaded by
31 SLIDES
405 VIEWS
310LIKES

Efficient Probe Selection in Micro-array Design

DESCRIPTION

Learn about algorithmic approaches for selecting unique DNA probes for gene identification in microarray experiments. Discover time and space-efficient methods with key performance metrics.

1 / 31

Download Presentation

Efficient Probe Selection in Micro-array Design

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Efficient Probe Selectionin Micro-array Design Algorithmics Group, Dept. of Computer Science, University of Liverpool Speaker:Cindy Y. Li Joint work with: Leszek Gąsieniec, Paul Sant, and Prudence Wong Special thanks go to: David Peleg http://www.csc.liv.ac.uk/~cindy

  2. Talk Overview • Background: Microarrays & Hybridization • Problem Statement • Our Approach • Experimental Work • Conclusion http://www.csc.liv.ac.uk/~cindy

  3. Hybridization Process DNA 5’... TGTGCTTGACAACATAGTTG... 3’ || | | Short DNA Fragments 3’-CTACGGACCGAT-5’ A single-stranded DNA probe (middle panel) is linked to an enzyme and allowed to base pair (hybridize) with the mRNA. After a series of washes, only fragments that are hybridized with the target mRNA remain. http://www.csc.liv.ac.uk/~cindy

  4. Labeled DNA/RNA mixture flushed over array of short DNA fragments Laser activation of fluorescent labels Tool: DNA Microarrays http://www.csc.liv.ac.uk/~cindy

  5. Talk Overview • Background: Microarrays & Hybridization • Problem Statement • Our Approach • Experimental Work • Conclusion http://www.csc.liv.ac.uk/~cindy

  6. Probe concept • A probe is a substring of a gene, which acts as its fingerprint (a.k.a., signature) • Probes are relatively short DNA sequences. Usually, a probe is ~ 20-25 base pairs long. • For example: DNA...TGTGCTTGGCAACATAGATAGATGC... ProbeTGCTTGGCAACATAGATAGA http://www.csc.liv.ac.uk/~cindy

  7. P1 P2 P3 P4 P5 Probes G1 G2 Genes G3 G4 Finding unique probes • We are interested in finding a single (or a small group of) unique probe(s) for each gene • The search process should be both time and space efficient http://www.csc.liv.ac.uk/~cindy

  8. Finding unique probes • Given a database S of gene sequences • For each sequence g in S try tofind a single probe P which hybridizes only with g • If P cross-hybridizes with some other sequences in S (i.e., P has a close occurrence in S) then find a small set of probes that uniquely identifies g. • Sometimes multiple probes are required due to the error prone wet lab environment http://www.csc.liv.ac.uk/~cindy

  9. The use of probes • The uniqueness of probes allows us to identify the genes taking part in the experiment in the wet lab • I.e., seeing the trace (green color) of a number of probes on the microarray we can identify precisely which genes were involved in the experiment http://www.csc.liv.ac.uk/~cindy

  10. Finding Unique Probes - Performance Measure • Each gene in the database S should be uniquely identified by a smallest possible number of probes • The search for probes should be time/space efficient • The time of the search for probes should be “fairly” independent of the length of the probes • All probes should be far (Hamming distance) from each other • Probes should satisfy some extra (e.g., related to hybridization process) conditions Naive approach: Scans through the whole length-n genome for every length-m probe and determine if the Hamming distance is big enough, which takes O(mn2) time. For example, 72 hours for S. pombe genome of length 7.1 x 106 bps and thus impractical for large genome. http://www.csc.liv.ac.uk/~cindy

  11. Previous Work – Approaches based on Suffix array and fast pattern matching[Li F. and Stormo G., 2001] BLAST to avoid cross-hybridization [Rouillard J. M., Herbert C. J. and Zuker M., 2002] Longest common substrings[Rahmann S. 2002] Various filtering techniques[Lockhart DJ et al, 1996] Methods based on pigeon hole principle [Lee W. H. and Sung W. K., 2003] etc http://www.csc.liv.ac.uk/~cindy

  12. Previous Work – The probe selection criteria • No single base exceeds 50% of the probe size • The length of any contiguous As and Ts or Cs and Gs is less than 25% of the probe size • (G+C)% is between 40% and 60% of the probe • Sensitivity - No self-complementarity within the probe sequence • Homogeneity - Melting Temperature not being too low or too high • Specificity – probes are unique to each gene http://www.csc.liv.ac.uk/~cindy

  13. Previous Work – Test data Test data http://www.csc.liv.ac.uk/~cindy

  14. Previous Work – Test data Total length 8,783,280 Total # of genes 5,888 http://www.csc.liv.ac.uk/~cindy

  15. Previous Work http://www.csc.liv.ac.uk/~cindy

  16. Talk Overview • Background: Microarrays & Hybridization • Problem Statement • Our new alternative approach - main observations - the algorithm • Experimental work • Conclusion http://www.csc.liv.ac.uk/~cindy

  17. Main Observations In general randomness help! • 80% of “randomly” (based on our algorithm) chosen candidates for probes satisfy the probe selection criteria related to hybridization process [this suggests that random sequences hybridize properly more likely] • The expected Hamming distance between two randomly chosen sequences of a length n over 4 letter alphabet is ~ 3n/4. [this suggests that randomly chosen probes will be far from each other] http://www.csc.liv.ac.uk/~cindy

  18. An interesting observation • In general, fragments of DNA sequences representing genes are more deterministic (contain more organized information) comparing to the rest of the sequence. • In contrary, the best probes (signatures) representing genes are very likely to be random or almost random! http://www.csc.liv.ac.uk/~cindy

  19. The Algorithm (*) For every gene g in the database S: • generate a random base-pair sequence of length m • find the closest length-m substring P in gene g • check P for good probe criteria[80% pass this test] • If P does not pass the criteria go to a) • cross-hybridization checking for P[98% pass this test] • For every length-m substringQin other sequences S-{g}: • If H(P,Q) > d, P is chosen as the probe for g, goto (*) • Otherwise, P can possibly cross-hybridize and we must generate another length-m random substring P', go to a) http://www.csc.liv.ac.uk/~cindy

  20. R P b) find the closest length-m substring P in gene g g The algorithm (*) For every gene g in the database S: a) generate a random base-pair sequence of length m c) Check Pfor good probe criteria, if P does not pass the criteria, go to a) http://www.csc.liv.ac.uk/~cindy

  21. P is far from g1√ gi g1 Background Sequences Pis far fromg2√ g2 … H(P,Q)<d X Q The algorithm • d) Check P for cross-hybridization checking • For every length-m substringQin other sequences (S - {g}): • If H(P,Q) > d, P is chosen as the probe for g, goto (*); • Otherwise, P can possibly cross-hybridize and we must generate another length-m random substring, go to a) g P Generate another length-m random substring http://www.csc.liv.ac.uk/~cindy

  22. Talk Overview • Background: Microarrays & Hybridization • Problem Statement • Algorithm • Experimental Work • Conclusion http://www.csc.liv.ac.uk/~cindy

  23. Experimental Work For Yeast: • 1.80% genes with no probes • Duplicated / very similar / too short • apart from that • 98.0% genes need only one probe • 1.5% genes need two probes • 0.5% genes need three probes Similar result with genome E.coli http://www.csc.liv.ac.uk/~cindy

  24. Talk Overview • Background: Microarrays & Hybridization • Problem Statement • Algorithm • Experimental Work • Conclusion http://www.csc.liv.ac.uk/~cindy

  25. Conclusion • Almost all (98%) genes can be uniquely identified by a single probe; the others need at most three probes • Our method is: • Suitable for large scale probe design • Fairly independent from the length of probes • Both time and space efficient • Useful in design of fault-tolerant system of probes http://www.csc.liv.ac.uk/~cindy

  26. P2’ P2 g1 P1 P1’ g2 g3 Ongoing Work Distinguish multiple targets in a sample http://www.csc.liv.ac.uk/~cindy

  27. ? ? ? Questions http://www.csc.liv.ac.uk/~cindy

  28. Thank You! Presented By Cindy Y. Li http://www.csc.liv.ac.uk/~cindy

  29. self-complementarity Probe 5‘ TTTCAGTAATAAAAGATTTCTGT3‘ |||| Probe 3‘TGTCTTTAGAAAAATTAGACTTT 5‘ http://www.csc.liv.ac.uk/~cindy

  30. Melting Temperature • TM can be used as a parameter to evaluate probe hybridization behavior • TM is calculated for each probe as (SantaLucia et al., 1996) is the sum of the nearest neighbor enthalpy changes is the sum of the nearest neighbor entropy changes R is the Gas Constant (1.987 cal deg-1 mol-1) CTis the total molar concentration of strands () http://www.csc.liv.ac.uk/~cindy

  31. TTTCAGTAATTAAAAAGATTTCTGT -1.2 -1.7 -1.5 kcal/mol Melting Temperature • thermodynamic stability / nearest neighbour/ http://www.csc.liv.ac.uk/~cindy

More Related