polymerase chain reaction pcr2 l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Polymerase Chain Reaction (PCR2) PowerPoint Presentation
Download Presentation
Polymerase Chain Reaction (PCR2)

Loading in 2 Seconds...

play fullscreen
1 / 37

Polymerase Chain Reaction (PCR2) - PowerPoint PPT Presentation


  • 627 Views
  • Uploaded on

Polymerase Chain Reaction (PCR2) fourth lecture Zoology department 2007 Dr.Maha H. Daghestani PCR Definition of PCR Requirements for PCR PCR Process A. Denaturing Stage B. Annealing Stage C. Extending Stage Polymerase Chain Reaction (PCR

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Polymerase Chain Reaction (PCR2)' - niveditha


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
polymerase chain reaction pcr2

Polymerase Chain Reaction(PCR2)

fourth lecture Zoology department

2007

Dr.Maha H. Daghestani

slide2
PCR
  • Definition of PCR
  • Requirements for PCR
  • PCR Process

A. Denaturing Stage

B. Annealing Stage

C. Extending Stage

polymerase chain reaction pcr
Polymerase Chain Reaction(PCR
  • One of the most powerful tools in molecular biology
  • Invented by Kary Mullis in 1983, resulting in his Nobel Prize in Chemistry
  • In essence, this process acts as a “copying machine” for DNA
pcr what is it
PCR What is it?

The Polymerase Chain Reaction (PCR) is an

invitro method to amplify a specific region of DNA.

PCR is extremely sensitive, with the capability of amplifying minuscule quantities of DNA.

advances due to pcr
Advances due to PCR

-Study DNA sequencing

-Compare forensic samples

-Identify remains

  • Disease diagnosis
  • Paternity determination

-Unite living members of a separated family

-Determine tissue type for transplants

-Amplify cDNA fragments from the reverse transcription products of mRNA (RT-PCR).

-Determine the SNPs and mutation in genes

tools for pcr
Tools for PCR
  • A small amount of DNA
  • DNA polymerace enzymes
  • Nucleotides
  • Primers
    • Two different kind
    • Usually about 20 nucleotides
requirements
REQUIREMENTS
  • DNA sample

· very small amounts (ng or sometimes less) if DNA is in good shape

· may be able to use DNA from only one cell

· only a few molecules must be intact

samples with larger numbers of molecules can be in poor shape or degraded

pcr requirements cont d
PCR REQUIREMENTS (cont’d.)
  • Two primers

· flank region you are interested in

· you must know the sequence of the flanking regions so you can order appropriate primers

  • Heat stable polymerase
  • Four dNTPs
  • Reaction buffer (Tris, ammonium ions (and/or potassium ions), magnesium ions, bovine serum albumin)
  • Thermocycler(standard, but optional)

· changes temperature very rapidly for each cycle (denature, anneal, extend)

pcr method
PCR METHOD

There are four basic steps in PCR

1. Denaturing Stage

2. Annealing Stage

3. Extending Stage

4. Replication

the basic protocol
The basic protocol
  • Denaturation of DNA to single strands
  • Annealing of primers to DNA
  • Extension by polymerase
  • Repeat 30-35 times
melting point temperature
Melting Point Temperature
  • Denaturation
    • The more there is G or C, the higher Tm
    • The longer the primers, the higer Tm
primers
Primers
  • Usually about 20 nucleotides in length
  • Designed to flank the region to be amplified
  • Melting point determined by G-C and A-T content
    • Tm = 4 (G+C) + 2 (A+T)
    • Ex: a primer with 10 G/C and 10 A/T would have a Tm of 60oC 4(10) + 2(10)=60oC

5’

3’

Target DNA

3’

5’

pcr primers
PCR Primers
  • Go to Genbank, look up sequence of gene of interest
pcr primers15
PCR Primers

Identify gene sequence in DNA and mRNA sequence

select primers to use for PCR

CCAAGGTTGCACCATGGACAGGTGGCAGAAGTGGGATCTCATCCAAGAGTTACATCCCTGCCAAGGTTGCACCATGGACAGGTGGCAGAAGTGGGATCTCATCCAAGAGTTACATCCCTGCCTCTCACTTCCTCTCCTTACAGCCAAGGCTGATGACATTGTTGGCCCTGTGACGCATGACCTCTCACTTCCTCTCCTTACAGCCAAGGCTGATGACATTGTTGGCCCTGTGACGCATGAAATCTTTGAGAACAACGTCGTCCACTTGATGTGGCAGGAGCCGAAGGAGCCCAATGGTCTAATCTTTGAGAACAACGTCGTCCACTTGATGTGGCAGGAGCCGAAGGAGCCCAATGGTCTGATCGTGCTGTATGAAGTGAGTTATCGGCGATATGGTGATGAGGTAAGGCCCTTGACTCTGATCGTGCTGTATGAAGTGAGTTATCGGCGATATGGTGATGAGGTAAGGCCCTTGACTCTTGGGCATGCCCCTGCACACTTCAGCATGCCCCTTCAGAGTTGCACTTGGTACCTCCTTC

primers16
Primers

forward

5’

3’

Target DNA

3’

5’

reverse

problems with primers
Problems with primers
  • ”hairpin” structure
    • If 3’side is included in structure, the primer doesn’t work
  • Primer dimers
    • Only harm if the binding is formed at the 3’ends
the basic protocol18
The basic protocol
  • Denaturation of DNA to single strands
  • Annealing of primers to DNA
  • Extension by polymerase
  • Repeat 30-35 times
what time does it take
What time does it take?
  • Denaturation: 30 - 60 sec
  • Annealing: 30 - 60 sec
  • Doupling: 30 - 60 sec
  • 25 - 35 cycles only (otherwise enzyme decay causes artifacts)
  • 72oC for 5 min at end to allow complete elongation of all product DNA

Altogether: 7 min ( 8,5 min) * 25 (35) = 3h-5h

the basic protocol what s in the tube
The basic protocol—what’s in the tube

5’

3’

Target DNA

3’

5’

A

Free

nucleotides

B

primers

Buffer

containing

magnesium

Mg2+

Mg2+

Mg2+

Taq DNA

polymerase

Mg2+

Mg2+

Mg2+

the basic protocol denaturation
The basic protocol--denaturation

5’

3’

Target DNA

3’

5’

95oC

5’

3’

3’

5’

the basic protocol annealing
The basic protocol--annealing

5’

3’

Target DNA

3’

5’

A

B

primers

~55oC

5’

3’

B

5’

5’

A

3’

5’

the basic protocol extension
The basic protocol--extension

5’

3’

Target DNA

3’

5’

72oC

5’

3’

5’

Taq polymerase

5’

3’

5’

the basic protocol extension24
The basic protocol--extension

5’

3’

Target DNA

3’

5’

72oC

5’

3’

5’

5’

3’

5’

one one billion in about 2 hours
One One billion in about 2 hours!
  • At the end of each cycle, the amount of DNA has doubled
  • By the end of 30 cycles, you will have about 1 billion molecules from the original one you started with!!
what makes it work
What makes it work?
  • Taq polymerase!
  • Most enzymes would be killed at 95oC
  • Taq was isolated from Thermus aquaticus, a bacteria that grows in hot springs (~75oC)
  • This organism’s enzymes have adapted to the high temperature, so they can survive cycling through the high temperatures
the pcr machine
The PCR machine
  • Very rapidly changes the temperature between the various stages of the PCR process
  • Programmable for use with many different cycling parameters
has it worked
Has It Worked?
  • Check a sample by gel electrophoresis.
  • Is the product the size that you expected?
  • Is there more than one band?
  • Is any band the correct size?
  • May need to optimize the reaction conditions.
optimising the pcr reaction
Optimising the PCR Reaction
  • Annealing temperature of the primers.
  • The concentration of Mg2+ in the reaction.
  • The extension time.
  • (The denaturing and annealing times.)
  • (The extension temperature.)
  • (The amount of template and polymerase— “more is less”.)
theoretical basis of agarose gel electrophoresis
Theoretical Basis of Agarose Gel Electrophoresis
  • Agarose is a polysaccharide from marine alage that is used in a matrix to separate DNA molecules
  • Because DNA ia a (-) charged molecule when subjected to an electric current it will migrate towards a (+) pole
assessing the integrity of dna
Assessing the Integrity of DNA

High Quality Genomic DNA

>95% DNA will be of high molecular weight, migrating as intact band near the top of the gel

Very little evidence of smaller fragments indicated by a smear of many different sized DNA fragments

sequencing
Sequencing

Wild type

Heterozygous

sequencing35
Sequencing

Wild type

Heterozygous

Homozygous