genomics medicine http biochem158 stanford edu l.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
Genomics & Medicine http://biochem158.stanford.edu/ PowerPoint Presentation
Download Presentation
Genomics & Medicine http://biochem158.stanford.edu/

Loading in 2 Seconds...

play fullscreen
1 / 33

Genomics & Medicine http://biochem158.stanford.edu/ - PowerPoint PPT Presentation


  • 79 Views
  • Uploaded on

Genomics & Medicine http://biochem158.stanford.edu/. Simple Nucleotide Polymorphisms http://biochem158.stanford.edu/SNPs.html. Doug Brutlag Professor Emeritus of Biochemistry & Medicine Stanford University School of Medicine.

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'Genomics & Medicine http://biochem158.stanford.edu/' - nirav


Download Now An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
genomics medicine http biochem158 stanford edu
Genomics & Medicinehttp://biochem158.stanford.edu/

Simple Nucleotide Polymorphisms

http://biochem158.stanford.edu/SNPs.html

Doug Brutlag

Professor Emeritus of Biochemistry & Medicine

Stanford University School of Medicine

the genome is out of the bag http stanmed stanford edu 2010fall article1 html
The Genome is Out of the Baghttp://stanmed.stanford.edu/2010fall/article1.html
human genetic variation 2007 scientific breakthrough of the year
Human Genetic Variation2007 Scientific Breakthrough of the Year

Simple

Individual 1

Individual 2

Individual 3

Individual 4

simple or single nucleotide polymorphisms snps
Simple (or Single) Nucleotide Polymorphisms (SNPs)
  • SNPs are common variations which occur at > 15 million positions in human genome
  • SNP MAF frequency can vary from 50% to 0.1% of population
  • SNPS can serve as genetic markers
  • SNPs can be used for identifying individuals and forensics
  • SNPs are used for mapping & genome-wide association studies of complex disease
  • SNPs are used for ancestry tracking & family relationships
  • SNPs are used for estimating predisposition to disease
  • SNPs are associated with disease, usually do not cause them
  • SNPs are used to predict risk of common genetic diseases
  • SNPs are used for personalized medicine and genomics
  • SNPs are used for classifying patients in clinical trials

GCTGTATGACTAGAAGATCGAT

GCTGTATGACGAGAAGATCGAT

snps and mutations in the human genome
SNPs and Mutationsin the Human Genome
  • 15 million sites in the human genome where SNPs can occur
  • 3.8 million SNP sites cataloged in 270 individuals in the HapMap consortium
  • Another 11 million SNP sites cataloged in the 1000 Genome effort
  • 10 million sites are common (minor allele frequency: MAF > 5%)
  • Each individual has 3-5 million SNPs (common variations) relative to the reference human genome
  • Each individual also carries 300 to 500 rare mutations (more recent) many of which are lethal
a snp primer at ncbi http www ncbi nlm nih gov about primer snps html
A SNP Primer at NCBIhttp://www.ncbi.nlm.nih.gov/About/primer/snps.html
department of energy doe snp page http www ornl gov sci techresources human genome faq snps shtml
Department of Energy (DOE) SNP Pagehttp://www.ornl.gov/sci/techresources/Human_Genome/faq/snps.shtml
simple nucleotide polymorphisms snps
Simple Nucleotide Polymorphisms (SNPs)
  • SNPs are common variations in the genome (minor allele frequency or MAF between 50% and 1%)
  • Most SNPs are genetically neutral
    • Used in DNA fingerprints - forensics
    • Paternity tests
    • Immigration in the United Kingdom
    • Used to track ethnic migrations and ancestry
  • Some SNPs reflect distinguishing characteristics
    • Often the basis for racial & genetic discrimination or other stigma
  • Rarer variations cause disease. Unlike SNPs, these variations are rare, often called mutations.
  • Some SNPs linked to predisposition to disease
  • SNPs can serve as genetic markers for other traits
    • Clinical trials associate SNPs with drug efficacy
    • Clinical trials associate SNPs adverse drug reactions
    • Personal genomics associate SNPs with traits
      • 23andMe, Navigenics, DNADirect
types of snps http www ncbi nlm nih gov sites entrez db snp
Types of SNPshttp://www.ncbi.nlm.nih.gov/sites/entrez?db=snp
  • Non protein coding SNPs
    • Promoters
    • 5’ UTR
    • 3’ UTR
    • Introns
    • Intergenic Regions
    • Pseudogenes
    • Regulatory
      • Splicing
      • Transcriptional regulation (promoter & transcription factor binding sites)
      • Translational regulation (initiation or termination)
      • Regulatory miRNA target sites
  • Coding SNPs
    • Synonymous SNPs (third position variation)
    • Replacement SNPs (change Amino acid)
      • Functional SNPs (acceptable amino acid replacement)
      • Non-functional SNPs (traits & diseases)
human promoter snps
Human Promoter SNPs

© Gibson & Muse, A Primer of Genome Science

human hemoglobin gene http www ncbi nlm nih gov gene 3043
Human β-Hemoglobin Genehttp://www.ncbi.nlm.nih.gov/gene/3043
human hemoglobin gene http www ncbi nlm nih gov gene 304314
Human β-Hemoglobin Genehttp://www.ncbi.nlm.nih.gov/gene/3043
human hemoglobin gene snps http www ncbi nlm nih gov snp snp ref cgi locusid 3043
Human β-Hemoglobin Gene SNPshttp://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?locusId=3043
hemoglobin gene snp rs111645889 http www ncbi nlm nih gov snp snp ref cgi rs 111645889
β-Hemoglobin Gene SNP rs111645889http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=111645889
hemoglobin gene snp rs111645889 http www ncbi nlm nih gov snp snp ref cgi rs 11164588917
β-Hemoglobin Gene SNP rs111645889http://www.ncbi.nlm.nih.gov/SNP/snp_ref.cgi?rs=111645889
hemoglobin snp variation viewer http www ncbi nlm nih gov sites varvu gene 3043
β-Hemoglobin SNP Variation Viewerhttp://www.ncbi.nlm.nih.gov/sites/varvu?gene=3043
origin of haplotypes
Origin of Haplotypes

© Gibson & Muse, A Primer of Genome Science

linkage disequilibrium and recombination rate
Linkage Disequilibrium and Recombination Rate

© Gibson & Muse, A Primer of Genome Science

linkage disequilibrium ld across the human lpl gene
Linkage Disequilibrium (LD) Across the Human LPL Gene

© Gibson & Muse, A Primer of Genome Science

recombination hotspots are widespread and account for linkage disequilibrium structure
Recombination hotspots are widespread and account for linkage disequilibrium structure

7q21

© Gibson & Muse, A Primer of Genome Science

recombination hotspots are widespread and account for linkage disequilibrium structure25
Recombination hotspots are widespread and account for linkage disequilibrium structure

7q21

© Gibson & Muse, A Primer of Genome Science

observation of haplotypes
Observation of Haplotypes

Individual 1

Individual 2

Individual 3

Individual 4

© Gibson & Muse, A Primer of Genome Science

snps in populations
SNPs in Populations

© Gibson & Muse, A Primer of Genome Science

sequence and distance based phylogenies evolutionary trees
Sequence and Distance-Based Phylogenies (evolutionary trees)
  • Sequence-Based Methods (Parsimony)
    • Assigns mutations to branches
    • Minimize number of changes
    • Topology maximizes similarity of neighboring leaves
  • Distance-based methods
    • Branch lengths = D(i,j)/2 for sequences i, j
    • Distances must be metric
    • Distances can reflect time or number of changes
    • Distances must be relatively constant per unit branch length
slide29
A Haplotype Map of the Human Genomehttp://www.nature.com/nature/journal/v437/n7063/full/nature04226.html

© Francis Collins, 2008

10 000 genomes project evolutionary biology http www genome gov
10,000 Genomes Project Evolutionary Biologyhttp://www.genome.gov/
national human genome research institute http www genome gov
National Human Genome Research Institutehttp://www.genome.gov/