nero
Uploaded by
38 SLIDES
588 VIEWS
380LIKES

Simple Animals, Complex Genomes

DESCRIPTION

Simple Animals, Complex Genomes Comparative genomics of sponges, sea anemones, and multicellular pancakes Mansi Srivastava Rokhsar Lab, Department of Molecular and Cell Biology, UC Berkeley Reddien Lab, Whitehead Institute for Biomedical Research 02.23.13. Outline. Introduction

1 / 38

Download Presentation

Simple Animals, Complex Genomes

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Simple Animals, Complex Genomes Comparative genomics of sponges, sea anemones, and multicellular pancakes Mansi Srivastava Rokhsar Lab, Department of Molecular and Cell Biology, UC Berkeley Reddien Lab, Whitehead Institute for Biomedical Research 02.23.13

  2. Outline • Introduction • Insights from genomic analyses • 3. Linking genomic complexity to biological complexity

  3. What is the genomic basis for the difference in complexity? BILATERIANS PLACOZOANS SPONGES CNIDARIANS bilateral symmetry, centralized nervous system true muscle true gut nervous system tissue grade ? multicellularity

  4. Three species were selected for genome sequencing SEA ANEMONE PLACOZOAN SPONGE

  5. Nematostellavectensisis a sea anemone Nematostella is a great lab rat (Finnerty et al. 2004)

  6. Trichoplaxis a placozoan (photo credits: Ana Signorovitch, Michael Eitel, Bernd Schierwater)

  7. Amphimedonqueenslandica is a sponge Adult Larvae (photo credits: Bernie Degnan)

  8. These animal genomes have been sequenced using a Whole Genome Shotgun strategy ATTTGCATGCGTAATTCAAT CGTAATTCAATGTGTGATTC ATTTGCATGCGTAATTCAAT CGTAATTCAATGTGTGATTC ATTTGCATGCGTAATTCAATGTGTGATTC

  9. These animal genomes have different sizes, but the numbers of genes/proteins are in the same ballpark Genome exon intron Genes Proteins

  10. Before comparing their genomes, we need to know how these animals are related to each other and to us * * * * * * BILATERIANS BILATERIANS Not an ancient animal gene Ancient animal gene Lost in sponges

  11. Orthologous protein sequences can reveal how organisms are related to each other RLKMTPIR PIDWDCMW RKLPDCMW MTLPDCMW fly fish human mouse Live birth, hair, warm blood, four chambered heart vertebrae RLKMTPIR PIDWDCMW RKLPDCMW MTLPDCMW

  12. Placozoans represent a sister lineage to cnidarians and bilaterians Cnidaria Bilateria Animals

  13. Whole-genome data can resolve early animal relationships BILATERIANS SPONGES PLACOZOANS CNIDARIANS bilateral symmetry, centralized nervous system true muscle true gut nervous system tissue grade multicellularity

  14. Previously, some developmental processes were thought to be conserved in the bilaterian ancestor A-P patterning Hoxcomplex Gene structure or genome organization (except for the Hox cluster) were not known to be ancient

  15. How do the structures of genes compare between animal genomes? Genome exon intron Genes Proteins

  16. Sea anemones, placozoans, and sponges have preserved many (>80%) ancient introns (this is not the case for flies and nematodes, which have lost a majority of ancestral metazoan introns) (in collaboration with UffeHellsten)

  17. What about how genes are organized relative to each other?

  18. The positions of orthologous genes can be compared between two species

  19. Gene order conservation decreases with evolutionary distance Synteny “same thread” genes present on the same chromosome

  20. No chromosome scale syntenyis observed between vertebrates and flies Human Drosophila

  21. Nematostella, Trichoplax, and Amphimedon scaffolds show conserved synteny with human chromosome segments (Nik Putnam)

  22. There is considerable scrambling of gene order in these blocks of conserved synteny (Nik Putnam)

  23. What is the significance of this conserved synteny?

  24. Another way to compare genomes is in terms of gene content…

  25. Trichoplax has genes for neurons and epithelial cells

  26. Trichoplax has genes for developmental signaling pathways

  27. Early animal lineages may lack certain cell types or biological processes, but their genomes encode the proteins required for these in bilaterians

  28. Many “important” genes are involved in processes essential for animal multicellularity Six hallmarks of animal multicellularity: Regulated cell cycle and growth Programmed cell death Cell-cell and cell-matrix adhesion Allorecognitionand innate immunity Specialization of cell types Developmental signaling

  29. Comparing early animal genomes allows us to study the temporal origins of animal biology Six hallmarks of animal multicellularity: Regulated cell cycle and growth Programmed cell death Cell-cell and cell-matrix adhesion Developmental signaling Allorecognition and innate immunity Specialization of cell types

  30. Some essential controls on the cell cycle evolved when animals first appeared

  31. A-P patterning, Hoxcomplex

  32. Early animal genomes are (in some ways) more similar to our genome than are the genomes of flies and nematodes SPONGES PLACOZOANS CNIDARIANS BILATERIANS A-P patterning Hox complex Metazoan “toolkit” Most signaling pathway and transcription factor families, intron-exon structure, genome organization

  33. Explanations for differences in complexity SPONGES PLACOZOANS CNIDARIANS BILATERIANS microRNAs? cis-regulation? larger families? A-P patterning Hox complex Most signaling pathway and transcription factor families, intron-exon structure, genome organization

  34. Differences in the numbers of some types of genes do correlate with complexity

  35. Explanations for differences in complexity SPONGES PLACOZOANS CNIDARIANS BILATERIANS microRNAs? cis-regulation? larger families? A-P patterning Hoxcomplex Cell types patterned in complex ways? Most signaling pathway and transcription factor families, intron-exon structure, genome organization

  36. Summary • Animals evolved a “toolkit” of genes very early in their evolution • Early animal genomes are complex! • (as are these animals) • Though not all questions are answered by the genomes, they are essential tools for finding the remaining answers

  37. Acknowledgements Dan Rokhsar Nik Putnam, Oleg Simakov Jarrod Chapman, EminaBegovic Therese Mitros, UffeHellsten Heather Marlow and Mark Martindale (U. Hawaii) Kai Kamm, Michael Eitel, Bernd Schierwater (Hanover) Ana Signorovitch, Maria Moreno, Leo Buss, Stephen Dellaporta (Yale) Degnan group (U. Queensland), Kosik group (UC Santa Barbara) Peter Reddien Jessica Witchley, Kathleen Mazza Members of the Reddien Lab Ulf Jondelius, Swedish Museum of Natural History Wolfgang Sterrer, Bermuda Natural History Museum

More Related