moshe
Uploaded by
23 SLIDES
361 VIEWS
230LIKES

Translation

DESCRIPTION

This guide explains the three major types of RNA: messenger RNA (mRNA), which transports genetic information from DNA in the nucleus to the cytoplasm; transfer RNA (tRNA), which translates the information into amino acids; and ribosomal RNA (rRNA), which forms ribosomes to synthesize proteins. The translation process involves ribosomes clamping onto mRNA, decoding codons, and assembling amino acids into polypeptides. Key steps include tRNA binding, peptide bond formation, and the eventual release of the newly formed polypeptide upon reaching a stop codon.

1 / 23

Download Presentation

Translation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Translation

  2. RNA Types Three types of RNA: • messenger RNA (mRNA) - brings DNA information from the nucleus to the cytoplasm • transfer RNA (tRNA) - translator molecule between nucleic acids and amino acids • ribosomal RNA (rRNA) – molecule used to make ribosomes, which synthesize protein

  3. Ribosomes • the location where translation occurs • made of protein and rRNA • consists of two parts (eukaryotic) • larger unit • smaller unit

  4. DNA TRANSCRIPTION mRNA Ribosome TRANSLATION Polypeptide Amino acids Polypeptide tRNA with amino acid attached Ribosome Trp Phe Gly tRNA C C C G G Anticodon A A A A G G G U G U U U C Codons 5 3 mRNA Ribosomal Role • Ribosome recognizes 5’ cap of mRNA strand • mRNA is clamped between the two subunits • rRNA recognize a specific sequence on the mRNA (start codon) • ribosome moves along the mRNA 5’  3’ in a given reading frame to create a polypeptide

  5. Reading Frames • reading frame – a sequence of codon triplets which result in protein formation 5’ AUGCCAGAUGCCAUCCAAGGCC 3’ 5’ AUG CCA GAU GCC AUC CAA GGC C 3’ 5’ A UGC CAG AUG CCA UCC AAG GCC 3’

  6. tRNA • tRNA – transfer RNA; translates between nucleic acids and amino acids amino acids attach here anticodon – three bases at the bottom of the tRNA which recognize the codon triplets on the mRNA through complementary base pairing anticodon

  7. tRNA Activation • tRNA activation - enzymes attach the appropriate amino acid to a tRNA (according to genetic code) • 20 different enzymes which attach the 20 different amino acids • aminoacyl-tRNA– a tRNA with the correct amino acid attached AA tRNA Aminoacyl tRNA

  8. Activated tRNA

  9. Ribosomal Structure • ribosomes have three pockets which can bind tRNA • acceptor (A) site • peptide (P) site • exit (E) site • ribosomes translocate along the mRNA strand to make proteins P A E

  10. Translation Steps • Ribosome binds to mRNA strand • First tRNA binds to A-site • Ribosome shifts 5’  3’ on mRNA moving the first tRNA into the P-site • Second tRNA binds to A-site • Peptide bond forms between amino acids • Ribosome shifts 5’  3’ on mRNA moving first tRNA into E-site, second tRNA into P-site • New tRNA can now bind to A-site • Continue until a stop codon is reached

  11. Large ribosomal subunit P site 5 3 U C A Met Met 3 A 5 G U Initiator tRNA GDP GTP E A mRNA 5 5 3 3 Start codon mRNA binding site Translation initiation complex Small ribosomal subunit 2 1 The arrival of a large ribosomal subunit completes the initiation complex. Proteins called initiation factors (not shown) are required to bring all the translation components together. GTP provides the energy for the assembly. The initiator tRNA is in the P site; the A site is available to the tRNA bearing the next amino acid. A small ribosomal subunit binds to a molecule of mRNA. In a prokaryotic cell, the mRNA binding site on this subunit recognizes a specific nucleotide sequence on the mRNA just upstream of the start codon. An initiator tRNA, with the anticodon UAC, base-pairs with the start codon, AUG. This tRNA carries the amino acid methionine (Met). Figure 17.17 Initiation

  12. 1 Codon recognition. The anticodon of an incoming aminoacyl tRNA base-pairs with the complementary mRNA codon in the A site. Hydrolysis of GTP increases the accuracy and efficiency of this step. Amino end of polypeptide DNA TRANSCRIPTION mRNA Ribosome TRANSLATION Polypeptide E mRNA 3 P A Ribosome ready for next aminoacyl tRNA site site 5 GTP 2 GDP 2 E E P A P A 2 GDP Peptide bond formation. An rRNA molecule of the large subunit catalyzes the formation of a peptide bond between the new amino acid in the A site and the carboxyl end of the growing polypeptide in the P site. This step attaches the polypeptide to the tRNA in the A site. 3 GTP Translocation. The ribosome translocates the tRNA in the A site to the P site. The empty tRNA in the P site is moved to the E site, where it is released. The mRNA moves along with its bound tRNAs, bringing the next codon to be translated into the A site. E P A Figure 17.18

  13. Translation Termination • no tRNA exist for the STOP codons • a release factor recognizes the stop codons and releases the peptide chain from the ribosome • ribosomes dissociate from the mRNA

  14. Release factor Free polypeptide 5 3 3 3 5 5 Stop codon (UAG, UAA, or UGA) The release factor hydrolyzes the bond between the tRNA in the P site and the last amino acid of the polypeptide chain. The polypeptide is thus freed from the ribosome. When a ribosome reaches a stop codon on mRNA, the A site of the ribosome accepts a protein called a release factor instead of tRNA. The two ribosomal subunits and the other components of the assembly dissociate. 2 1 3 Figure 17.19 Termination

  15. Completed polypeptide Growing polypeptides Incoming ribosomal subunits Polyribosome Start of mRNA (5 end) End of mRNA (3 end) (a) An mRNA molecule is generally translated simultaneously by several ribosomes in clusters called polyribosomes. Ribosomes mRNA 0.1 µm (b) This micrograph shows a large polyribosome in a prokaryotic cell (TEM). Figure 17.20a, b

  16. Protein Modification • proteins are folded properly after being released from the ribosome by chaperonin proteins • other functional groups or larger molecules may be added to the protein • proteins may also be cleaved into different pieces to carry out their specific functions

  17. Protein Modification chaperonin

  18. Translation Animation http://www.youtube.com/watch?v=5bLEDd-PSTQ

  19. DNA TRANSCRIPTION 3 2 1 4 5 RNA is transcribed from a DNA template. 3 Poly-A RNA transcript 5 RNA polymerase Exon RNA PROCESSING RNA transcript (pre-mRNA) In eukaryotes, the RNA transcript (pre- mRNA) is spliced and modified to produce mRNA, which moves from the nucleus to the cytoplasm. Intron Aminoacyl-tRNA synthetase Cap NUCLEUS Amino acid FORMATION OF INITIATION COMPLEX AMINO ACID ACTIVATION tRNA CYTOPLASM After leaving the nucleus, mRNA attaches to the ribosome. Each amino acid attaches to its proper tRNA with the help of a specific enzyme and ATP. Growing polypeptide mRNA Activated amino acid Poly-A Poly-A Ribosomal subunits Cap 5 TRANSLATION C C A U A succession of tRNAs add their amino acids to the polypeptide chain as the mRNA is moved through the ribosome one codon at a time. (When completed, the polypeptide is released from the ribosome.) A E A C Anticodon A A A U G U G G U U U A Codon Ribosome

  20. Membrane Embedded Synthesis Ribosomes are found • free in the cytoplasm • attached to the endoplasmic reticulum Polypeptides designed to be integral proteins must be brought to the ER for synthesis.

  21. Membrane Embedded Synthesis All membrane-embedded polypeptides begin with an N-terminal signal of ~20 amino acids called the signal peptide. A signal recognition particle (SRP) binds to the signal peptide to bring the ribosome and growing polypeptide chain to the ER to continue synthesis The signal peptide is cleaved once the polypeptide is secure in the membrane

  22. Membrane Embedded Synthesis

  23. Classwork/Homework • Pg. 254 #1-10

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer