Sequence Similarity: Pairwise Alignment in Bioinformatics
E N D
Presentation Transcript
Pairwise Alignment How do we tell whether two sequences are similar? Assigned reading: Ch 4.1-4.7, Ch 5.1, get what you can out of 5.2, 5.4 BIO520 Bioinformatics Jim Lund
DNA:DNA polypeptide:polypeptide Pairwise alignment The BASIC SequenceAnalysis Operation
Pairwise sequence alignments One-to-One One-to-Database Multiple sequence alignments Many-to-Many Alignments
Homology common evolutionary descent Chance Short similar segments are very common. Similarity in function Convergence (very rare) Origins of Sequence Similarity
Visual sequence comparison: Filtered dotplot 4 bp window, 75% identity cutoff
Visual sequence comparison: Dotplot 4 bp windw, 75% identity cutoff
Assessing similarity GAACAAT ||||||| 7/7 OR 100% GAACAAT Which is BETTER? How do we SCORE? GAACAAT | 1/7 or 14%GAACAAT
MISMATCH Similarity GAACAAT ||||||| 7/7 OR 100% GAACAAT GAACAAT ||| ||| 6/7 OR 84% GAATAAT
Mismatches GAACAAT ||| ||| 6/7 OR 84% GAATAAT Same?? GAACAAT ||| ||| 6/7 OR 84% GAAGAAT
Count this? Terminal Mismatch GAACAATttttt ||| ||| aaaccGAATAAT 6/7 OR 84%
INDEL INDELS GAAgCAAT ||| |||| 7/7 OR 100% GAA*CAAT
vs. GAAggggCAAT ||| |||| GAA****CAAT Indels, cont’d GAAgCAAT ||| |||| GAA*CAAT
Common Method: Terminal mismatches (0) Match score (1) Mismatch penalty (-3) Gap penalty (-1) Gap extension penalty (-1) Similarity Scoring DNA Defaults
DNA Scoring GGGGGGAGAA |||||*|*|| 8(1)+2(-3)=2 GGGGGAAAAAGGGGG GGGGGGAGAA--GGG |||||*|*|| ||| 11(1)+2(-3)+1(-1)+1(-1)=3 GGGGGAAAAAGGGGG
Absurdity of Low Gap Penalty GATCGCTACGCTCAGC A.C.C..C..T Perfect similarity, Every time!
Local alignment Smith-Waterman Global alignment Needleman-Wunsch Sequence alignment algorithms
Local alignment (Smith-Waterman) BLAST (simplified Smith-Waterman) FASTA (simplified Smith-Waterman) BESTFIT (GCG program) Global alignment (Needleman-Wunsch) GAP Alignment Programs
Local vs. global alignment 10 gaggc 15 ||||| 3 gaggc 7 Local alignment: alignment of regions of substantial similarity 1 gggggaaaaagtggccccc 19 || |||| || 1 gggggttttttttgtggtttcc 22 Global alignment: alignment of the full length of the sequences
Look for local alignment, a High Scoring Pair (HSP) Finding word (W) in query and subject. Score > T. Extend local alignment until score reaches maximum-X. Keep High Scoring Segment Pairs (HSPs) with scores > S. Find multiple HSPs per query if present Expectation value (E value) using Karlin-Altschul stats BLAST Algorithm
BLAST statistical significance:assessing the likelihood a match occurs by chance Karlin-Altschul statistic: E = k m N exp(-Lambda S) m = Size of query seqeunce N = Size of database k = Search space scaling parameter Lambda = scoring scaling parameter S = BLAST HSP score Low E -> good match
BLAST statistical significance: • Rule of thumb for a good match: • Nucleotide match • E < 1e-6 • Identity > 70% • Protein match • E < 1e-3 • Identity > 25%
Identity - Easy WEAK Alignments Chemical Similarity L vs I, K vs R… Evolutionary Similarity How do proteins evolve? How do we infer similarities? Protein Similarity Scoring
CAU=H CAC=H CGU=R UAU=Y CAA=Q CCU=P GAU=D CAG=Q CUU=L AAU=N Single-base evolution changes the encoded AA
Two main classes: PAM-Dayhoff BLOSUM-Henikoff Substitution Matrices
Built from closed related proteins, substitutions constrained by evolution and function “accepted” by evolution (Point Accepted Mutation=PAM) 1 PAM::1% divergence PAM120=closely related proteins PAM250=divergent proteins PAM-Dayhoff
Built from ungapped alignments in proteins: “BLOCKS” Merge blocks at given % similar to one sequence Calculate “target” frequencies BLOSUM62=62% similar blocks good general purpose BLOSUM30 Detects weak similarities, used for distantly related proteins BLOSUM-Henikoff&Henikoff
No general theory for significance of matches!! G+L(n) indel mutations rare variation in gap length “easy”, G > L Gapped alignments
Real Alignments Protein-Protein Close-Distant DNA-DNA
Phylogeny Myoglobin
Cow-to-Pig Protein 88% identical
Cow-to-Pig cDNA 80% Identity (88% at aa!)
Coding vs Non-coding Regions 90% in coding (70% in non-coding)
Third Base of Codon is Hypervariable 28 third base 11 second 8 first
Cow-to-Fish Protein 42% identity, 51% similarity
Cow-to-Fish DNA 48% similarity
Polypeptide similarity > DNA Coding DNA > Non-coding 3rd base of codon hypervariable Moderate Distance poor DNA similarity Protein vs. DNAAlignments
DNA-DNA similarities 50% significant if “long” E < 1e-6, 70% identity Protein-protein similarities 80% end-end: same structure, same function 30% over domain, similar function, structure overall similar 15-30% “twilight zone” Short, strong match…could be a “motif” Rules of Thumb
BLASTN DNA to DNA database BLASTP protein to protein database TBLASTN DNA (translated) to protein database BLASTX protein to DNA database (translated) TBLASTX DNA (translated) to DNA database (translated) Basic BLAST Family
nr (non-redundantish merge of Genbank, EMBL, etc…) EXCLUDES HTGS0,1,2, EST, GSS, STS, PAT, WGS est (expressed sequence tags) htgs (high throughput genome seq.) gss (genome survey sequence) vector, yeast, ecoli, mito chromosome (complete genomes) And more DNA Databases http://www.ncbi.nlm.nih.gov/BLAST/blastcgihelp.shtml#nucleotide_databases
nr (non-redundant Swiss-prot, PIR, PDF, PDB, Genbank CDS) swissprot ecoli, yeast, fly month And more Protein Databases
Program Database Options - see more Sequence FASTA gi or accession# BLAST Input >one line gggtcgagtac
Algorithm and output options # descriptions, # alignments returned Probability cutoff Strand Alignment parameters Scoring Matrix PAM30, PAM70, BLOSUM45, BLOSUM62, BLOSUM80 Filter (low complexity) PPPPP->XXXXX BLAST Options
Gapped Blast (default) PSI-Blast (Position-specific iterated blast) “self” generated scoring matrix PHI BLAST (motif plus BLAST) BLAST2 client (align two seqs) megablast (genomic sequence) rpsblast (search for domains) Extended BLAST Family