1 / 18

Gene to Protein: Understanding the Central Dogma of Genetics

Explore the flow of genetic information from DNA to protein, including transcription and translation processes. Learn about the role of RNA in gene expression and the importance of splicing for accurate protein synthesis.

mira-weeks
Download Presentation

Gene to Protein: Understanding the Central Dogma of Genetics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. From Gene to Protein How Genes Work

  2. What do genes code for? • How does DNA code for cells & bodies? • how are cells and bodies made from the instructions in DNA DNA proteins cells bodies

  3. The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? RNA DNA protein trait

  4. 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"

  5. aa aa aa aa aa aa aa aa aa aa aa From gene to protein nucleus cytoplasm DNA mRNA protein trait

  6. Transcription fromDNA languagetoRNA language

  7. RNA • ribose sugar • N-bases • ____________________ • ____________________ • ____________________ • ____________________ • lots of RNAs • mRNA, tRNA, rRNA, siRNA… transcription DNA RNA

  8. Transcription • Making mRNA • transcribed DNA strand = ___________________ • enzyme • __________________________ 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

  9. Initiation • ________________________ • binding site before beginning of gene • __________________________________ • binding site for RNA polymerase

  10. RNA polymerase Elongation A • Match RNA bases to DNA bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U 5' 3' A G C C A T G G T A C A G C T A G T C A T C G T A C C G T

  11. Termination • Eventually the RNA transcript is released and the polymerase detaches (complete mechanism still not fully known)

  12. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Eukaryotic genes have junk! • Eukaryotic genes are not continuous • ___________ = the real gene • expressed / coding DNA • ___________ = the junk • inbetween sequence eukaryotic DNA

  13. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA splicing • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • ______________________________ • ______________________________ • edit out introns • ______________________________ ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

  14. Splicing must be accurate • No room for mistakes! • a single base added or lost throws off the _______________________ AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|

  15. snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' RNA splicing enzymes

  16. Alternative splicing • _______________________________________ • when is an intron not an intron… • different segments treated as exons

  17. 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G More post-transcriptional processing • Need to protect mRNA on its trip from nucleus to cytoplasm • enzymes in cytoplasm attack mRNA • protect the ends of the molecule • ________________________________ • ________________________________

  18. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

More Related