polymorphismes carte liaison g n tiques n.
Skip this Video
Loading SlideShow in 5 Seconds..
POLYMORPHISMES CARTE & LIAISON GÉNÉTIQUES PowerPoint Presentation
Download Presentation
POLYMORPHISMES CARTE & LIAISON GÉNÉTIQUES

Loading in 2 Seconds...

  share
play fullscreen
1 / 47
Download Presentation

POLYMORPHISMES CARTE & LIAISON GÉNÉTIQUES - PowerPoint PPT Presentation

merle
76 Views
Download Presentation

POLYMORPHISMES CARTE & LIAISON GÉNÉTIQUES

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. 1 POLYMORPHISMESCARTE & LIAISON GÉNÉTIQUES M1 Génétique des Mammifères 2006 - LUMINY Laurent VILLARD Inserm Unité 491 Faculté de Médecine de La Timone http://www.team3-u491.net

  2. 2 POLYMORPHISMES A quelle condition peut-on étudier la transmission des caractères héréditaires ?

  3. ! 3 POLYMORPHISMES La transmission des caractères ne peut être étudiée que si ceux-ci sont POLYMORPHES. L'ADN humain est polymorphe Il existe environ 3.500.000 différences entre deux invidivus pris au hasard (0,1% de leur génome)

  4. 4 POLYMORPHISMES Ces variations dans la séquence d'ADN n'ont pas de conséquence pathologiques. Les polymorphismes sont le résultat de "mutations". Mutation : changement permanent et transmissible dans le matériel génétique Ceci implique que "mutation" n'est pas synonyme de "pathologie"

  5. 5 POLYMORPHISMES • Ces variations de séquence peuvent avoir lieu • dans les gènes hors des gènes •  avec une conséquencesans conséquence • groupe sanguin • couleur des yeux •  sans conséquence • synonymes

  6. 6 LES TYPES DE POLYMORPHISMES • RFLP Restriction Fragment Length Polymorphism •  MICROSATELLITES • SNP Single Nucleotide Polymorphisms

  7. 7 LES RFLP Restriction Fragment Length Polymorphism Suite à la découverte des enzymes de restriction (1973), une technique d’hybridation de sondes marquées va être développée (Southern blot, 1975) pour repérer un fragment de restriction particulier dans un mélange complexe d’ADN. En 1980, on découvre que certains fragments de restriction n’ont pas la même taille chez tous les individus… Pourquoi ?

  8. 8 LES RFLP Restriction Fragment Length Polymorphism Site de coupure EcoRI GAATTC CTTAAG Pas de coupure en cas GACTTC de modification du site CTGAAG (il s’agit souvent du polymorphisme d’un seul nucléotide)

  9. 9 LES RFLP 1 2 3 4 - électrophorèse Taille des fragments de restriction +

  10. 10 LES RFLP 1 2 3 4 - électrophorèse Taille des fragments de restriction +

  11. 11 LES RFLP * ADN PCR Site de restriction * Digestion Enzymatique Site variable Amorce PCR Électrophorèse 1 2 3 1,2 : Homozygotes 3 : Heterozygote

  12. 12 LES MICROSATELLITES Découverts en 1989, ce type de marqueurs polymorphe va petit à petit remplacer les RFLP. Il s'agit de séquences d'ADN constituées de motifs répétés avec 2, 3 ou 4 nucléotides : nnnnnnCACACACACACACACACACACACACAnnnnnnnn nnnnnnGTTGTTGTTGTTGTTGTTGTTGTTGTTnnnnnnnn nnnnnnATGGATGGATGGATGGATGGATGGATGGnnnnn nb variable de répétitions nb variable de répétitions nb variable de répétitions

  13. 13 LES MICROSATELLITES Les microsatellites sont des marqueurs multi-alléliques Allèle 1 …nnnnnnnnCACACACACACACACACAnnnnnnnnnnnn… …nnnnnnnnCACACACACACACACACAnnnnnnnnnnnn… Allèle 2 …nnnnnnnnnCACACACACACACACACACACACACAnnnnnnn… …nnnnnnnnnCACACACACACACACACACACACACAnnnnnnn… Allèle 3 …nnnnnnnnnnCACACACACACACACACACACAnnnnnnnn… …nnnnnnnnnnCACACACACACACACACACACAnnnnnnnn… 9 répétitions (CA) 13 répétitions (CA) 11 répétitions (CA)

  14. 14 LES MICROSATELLITES Chromosome (CA)n variable (locus polymorphe) CACACACACACA Fragments d’ADN amplifiés 1 2 3 4 5 Grands Électrophorèse Petits 6 allèles détectés

  15. 15 LES MICROSATELLITES Les marqueurs multi-alléliques sont plus intéressants pour les applications médicales ou légales que les marqueurs bi-alléliques. Pourquoi ?

  16. 16 LES MICROSATELLITES Le pourcentage d'hétérozygotie dans la population générale sera plus important que celui des marqueurs bi-alléliques. Locus bi-allélique : A1, A2 (n = 2) 3 génotypes possibles : A1A1, A1A2, A2A2 Fréquence des hétérozygotes = 1 - (n x f(A1) x f(A2)) = 1 - (2 x 0,5 x 0,5) = 0,5 50% d'hétérozygotes au maximum

  17. 17 LES MICROSATELLITES Locus multi-allélique : A1, A2, A3, A4….. An (n allèles) Nombre de génotypes homozygotes = n Nombre de génotypes possibles = n x (n+1) / 2 Pour un marqueur à 8 allèles = 8 x (8+1) / 2 = 36 génotypes (avec seulement 8 génotypes homozygotes) Fréquence des hétérozygotes = 1 - (8 x 0,125 x 0,125) = 0,875 87,5% d'hétérozygotes au maximum

  18. 18 LES SNP Single Nucleotide Polymorphisms Allèle A …AGCATAGCAGCAATCAGCGCAGCAGTCTCTCTTCGCAAGCA… …TCGTATCGTCGTTAGTCGCGTCGTCAGAGAGAAGCGTTCGT… Allèle B …AGCATAGCAGCAATCAGCACAGCAGTCTCTCTTCGCAAGCA… …TCGTATCGTCGTTAGTCGTGTCGTCAGAGAGAAGCGTTCGT…

  19. 19 LES SNP La base de données des SNP : dbSNP Contenu au 29-09-2005 Espèce Nombre de SNP distincts Homo sapiens 10 430 753 Canis familiaris 3 310 003 Gallus gallus 3 296 472 Mus musculus 1 833 763 Pan troglodytes 1 542 718

  20. ! 20 LES SNP Si un SNP modifie un site de restriction, il génère un RFLP. Déterminer les allèles présents à un locus = GÉNOTYPER Combien de génotypes possibles pour : Un RFLP ? Un microsatellite à n allèles ? Un SNP ?

  21. ! 20 LES SNP Si un SNP modifie un site de restriction, il génère un RFLP. Déterminer les allèles présents à un locus = GÉNOTYPER Combien de génotypes possibles pour : Un RFLP ? 3 (AA , AB , BB) Un microsatellite à n allèles ? n x (n+1) / 2 Un SNP ?3 (AA , AB , BB)

  22. 21 CARTOGRAPHIE Il existe deux types principaux de cartes : - les cartes génétiques les distances sont exprimées en centimorgan (cM) - les cartes physiques les distances sont exprimées en paires de bases (pb) kilobases (kb) = 1000 pb Mégabases (Mb) = 1000 kb

  23. 22 CARTOGRAPHIE GÉNÉTIQUE Elle est basée sur l’observation de la transmission des caractères héréditaires. Les distances génétiques sont le reflet de la fréquence de recombinaison. Pendant la méïose, les « crossing-over » provoquent l’échange de matériel génétique entre chromosomes homologues. Plus deux gènes (deux marqueurs) sont proches, moins ils ont de chances d’être séparés par un crossing-over et plus la distance génétique entre eux sera petite. A B C A B C

  24. 23 CARTOGRAPHIE GÉNÉTIQUE Lorsque deux marqueurs sont suffisamment proches pour n’être séparés qu’une fois sur 100, on fixe la distance génétique qui les sépare à 1 centimorgan (1 cM). Il s’agit d’une mesure équivalente à 1% de recombinaison. Si deux marqueurs ne sont pas « liés » (i.e. s’ils sont situés sur deux chromosomes différents) ils seront séparés (en moyenne) une fois sur deux. La fréquence de recombinaison maximale est donc de 50% (0,5).

  25. 24 CARTOGRAPHIE GÉNÉTIQUE L’étude des familles humaines permet de déterminer le mode de transmission des caractères héréditaires (pas forcément des maladies mais aussi de n’importe quel segment d’ADN polymorphe).

  26. 25 CARTOGRAPHIE GÉNÉTIQUE Ces études permettent de déterminer les fréquences de recombinaison entre ces caractères et donc de construire une CARTE GÉNÉTIQUE sur laquelle ces caractères seront positionnés les uns par rapport aux autres. Pour être informatives, ces études doivent étudier beaucoup de méïoses, donc de grandes familles.

  27. 26 CARTOGRAPHIE GÉNÉTIQUE Les SNPs ou microsatellites étant polymorphes, leur ségrégation peut être observée dans des familles : 8 4 2 7 5 3 8 10 p1 p2 m1 m2 2 4 5 10 8 7 8 10

  28. 27 CARTOGRAPHIE GÉNÉTIQUE L'établissement et l’utilisation d'une carte génétique permettent : D'établir des points d'ancrage pour la carte physique D'identifier la région (et le gène) responsable d'une maladie monogénique donnée D'étudier certaines particularités de la méiose, telle que la variation de fréquence des recombinaisons : en fonction du sexe en fonction de la région du génome

  29. 28 CARTOGRAPHIE GÉNÉTIQUE 1987 - Première version (CRI, familles du CEPH) 403 marqueurs (RFLP), résolution 10 cM 1992 - Seconde version (Généthon, familles du CEPH) 814 marqueurs (microsatellites), résolution 4,4 cM 1992 - Troisième version (NIH, CEPH) 1676 marqueurs (microsatellites + RFLP), résolution 3 cM 1994 - Quatrième version (Généthon) 2066 marqueurs (microsatellites), résolution 2,9 cM 1996 - Cinquième version (Généthon) 5264 marqueurs (microsatellites), résolution 1,6 cM

  30. 29 CARTOGRAPHIE GÉNÉTIQUE Les cartes disponibles ont principalement été construites en utilisant 40 grandes familles, collectées par le Centre d’Etude du Polymorphisme Humain (CEPH, Paris). 1- génotypage de tous les individus pour déterminer les allèles présents au marqueur étudié chez ces individus. 2- calcul des fréquences de recombinaison entre les marqueurs 3- observation des recombinaisons entre les marqueurs proches afin de confirmer leur ordre

  31. 30 CARTOGRAPHIE GÉNÉTIQUE

  32. 31 CARTOGRAPHIE GÉNÉTIQUE Carte génétique basse résolution du chromosome 1 Nomenclature des marqueurs : D pour DNA N numéro du chromosome S pour Sequence XXX numéro d’ordre Pour le chromosome 1 D1S243 D1S163 etc… Pour le chromosome X DXS441 DXS1116 etc…

  33. ! 32 ANALYSE DE LIAISON GÉNÉTIQUE LOD (Logarithm of the odds) SCORE (Z) C’est une valeur déterminée dans le cadre d’une ANALYSE DE LIAISON GENETIQUE Il s'agit d'une mesure statistique. C'est le logarithme du rapport des probabilités entre l'hypothèse proposée (liaison génétique) et l'hypothèse contraire (pas de liaison). Z = log10 LR LR = liaison / non liaison

  34. 33 ANALYSE DE LIAISON GÉNÉTIQUE Si le lod score est supérieur à 3 (c'est-à-dire que la liaison est mille fois plus probable que la non-liaison) on tranche, en général, dans le cas des maladies monogéniques autosomiques, en faveur de la liaison génétique.

  35. Z -2 0 +3 Non liaison Ajouter des familles… Liaison 34 ANALYSE DE LIAISON GÉNÉTIQUE Une valeur de lod score égale ou supérieure à 2 est acceptée comme étant significative pour le chromosome X. Les valeurs inférieures à -2 (100 chances pour 1 contre la liaison génétique) excluent une la liaison génétique.

  36. 35 ANALYSE DE LIAISON GÉNÉTIQUE Exemple : test de la liaison entre une pathologie et un marqueur microsatellite I A1/A2 A3/A4 II A1/A3 A5/A6 III A1/A6 A3/A6 A1/A6 A3/A6 A3/A5 A3/A5 A1/A5 Recombinant

  37. 36 ANALYSE DE LIAISON GÉNÉTIQUE 1- Il faut fixer une fraction de recombinaison q Si on suppose que le gène responsable et le marqueur sont au même endroit, elle sera égale à 0. Sinon, on fixe une fraction de recombinaison : par exemple 5% Cette valeur s’appelle q (théta). q varie entre 0 (identité de position) et 0,5 (non liaison). q = 5% signifie que le gène responsable et le marqueur considéré resteront liés dans 95 % des méioses observées. Une recombinaison sera observée dans 5% des méioses.

  38. 37 ANALYSE DE LIAISON GÉNÉTIQUE 2- Calcul de la probabilité de liaison Probabilité de liaison (non recombinaison) entre gène et marqueur Fraction de recombinaison de 5% = 0,95 Probabilité de liaison « au hasard » = 50% = 0,5 Rapport des probabilités (LR) avec les deux hypothèses = 0.95/0.5 = 1,9 donc un lod score Z = log10(LR) = 0,279 (pour un individu)

  39. 38 ANALYSE DE LIAISON GÉNÉTIQUE 3- Calcul de la probabilité de non liaison Probabilité de non liaison (recombinaison) entre gène et marqueur Fraction de recombinaison de 5% =0,05 probabilité de non liaison « au hasard » = 50% = 0,5 Rapport des probabilités de non liaison (LR) avec les deux hypothèses = 0.05/0.5 = 0,1 donc un lod score Z = log10 (LR) = -1 (pour un individu)

  40. 39 ANALYSE DE LIAISON GÉNÉTIQUE I A1/A2 A3/A4 II A1/A3 A5/A6 III A1/A6 A3/A6 A1/A6 A3/A6 A3/A5 A3/A5 A1/A5 Recombinant Dans cette famille avec 7 enfants (7 meioses) dont 1 recombinant : (6 x 0.279) + (1 x (-1)) = Z = 0.674 pour q = 0,05 au marqueur A3

  41. 40 ANALYSE DE LIAISON GÉNÉTIQUE En combinant plusieurs familles il devient possible d'établir une éventuelle liaison entre le marqueur testé (connu, ici A) et le gène non connu (responsable de la pathologie) mais qui sera ainsi localisé si Z > 3. Les individus recombinants font chuter le lod score = beaucoup de gamètes recombinants indique que le gène et le marqueur ont peu de chance d’être liés génétiquement… (- l’infini à q = 0)

  42. 41 ANALYSE DE LIAISON GÉNÉTIQUE Recombination fraction Marker 0.00 0.01 0.05 0.10 0.20 0.30 0.40 D7S484 -Infinity 2.47 2.68 2.39 1.60 0.83 0.24 D7S2449 9.02 8.79 7.86 6.70 4.44 2.39 0.75 D7S510 4.43 4.30 3.75 3.06 1.84 0.89 0.24 D7S691 5.49 5.32 4.64 3.79 2.18 0.93 0.24 D7S667 6.49 6.37 5.79 5.01 3.43 1.90 0.58 D7S519 2.37 2.51 2.68 2.56 1.93 1.12 0.32 D7S422 -Infinity 2.01 2.68 2.59 1.87 1.04 0.29 D7S506 -Infinity 0.77 2.23 2.33 1.71 0.92 0.26 D7S2552 -Infinity -0.71 0.86 1.30 1.21 0.72 0.20 D7S494 -Infinity -0.58 1.83 2.33 2.00 1.19 0.36 D7S502 -Infinity -0.75 1.12 1.61 1.51 0.94 0.28

  43. 42 LE PROJET HAPMAP Le projet HapMap vise à comparer la séquence du génome de différents individus pour identifier les régions où des variations génétiques sont partagées. Le projet est financé par les organismes publics de 6 pays. L'objectif est de mettre à disposition des chercheurs l'information qui leur permettra de mettre en évidence des liens entre variations génétiques et susceptibilité à certaines maladies.

  44. 43 LE PROJET HAPMAP Populations étudiées : Idaban (Nigéria) 30 trios (2 parents / 1 enfant) Tokyo (Japon) 45 individus sans lien de parenté Beijing (Chine) 45 individus sans lien de parenté Américains (USA) originaires d'Europe de l'Ouest et du Nord 30 trios (2 parents / 1 enfant)

  45. 44 LE PROJET HAPMAP Le projet HapMap veut identifier le maximum de SNP dans le génome humain et établir leurs cartes de répartition dans différentes populations. Cartographie de la diversité génétique de l'espèce humaine. Le projet HapMap identifie les haplotypes courants dans 4 populations. Il définit des SNP "marqueurs" qui identifient un haplotype. Ex : susceptibilité à l'hypertension ? Quels sont les SNPs hérités en commun chez tous les patients hypertendus ? Le(s) facteur(s) de susceptibilité doivent se trouver proche. On ne génotypera pas les 10,000,000 de SNP chez chaque individu. On connaît des associations préférentielles de marqueurs proches qui constituent des "haplotypes" de SNP, d'où le nom HapMap.

  46. 45 LE PROJET HAPMAP Les données du projet HapMap permettent des études d'association à grande échelle pour différentes pathologies : cancer accidents vasculaires cérébraux maladies du coeur diabète hypertension… A terme traitements adaptés au profil génétique des individus ("pharmacogénomique") "variants" génétique associés à la longévité, à la résistance aux maladies ? développement de nouvelles thérapies ?