mycobacterium ulcerans n.
Download
Skip this Video
Loading SlideShow in 5 Seconds..
MYCOBACTERIUM ULCERANS PowerPoint Presentation
Download Presentation
MYCOBACTERIUM ULCERANS

Loading in 2 Seconds...

play fullscreen
1 / 27

MYCOBACTERIUM ULCERANS - PowerPoint PPT Presentation


  • 542 Views
  • Uploaded on

MYCOBACTERIUM ULCERANS. Les méthodes de diagnostic moléculaire et d’empreintes génétiques pour Mycobacterium ulcerans. Introduction. PCR =polymerase chain reaction (basée sur IS 2404) but = Détection des matières génétiques PCR conventionnelle pour la confirmation Nested PCR

loader
I am the owner, or an agent authorized to act on behalf of the owner, of the copyrighted work described.
capcha
Download Presentation

PowerPoint Slideshow about 'MYCOBACTERIUM ULCERANS' - kyleigh


An Image/Link below is provided (as is) to download presentation

Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author.While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server.


- - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript
mycobacterium ulcerans

MYCOBACTERIUM ULCERANS

Les méthodes de diagnostic moléculaire et d’empreintes génétiques pour Mycobacterium ulcerans

introduction
Introduction
  • PCR =polymerase chain reaction (basée sur IS2404)
    • but =
      • Détection des matières génétiques
        • PCR conventionnelle pour la confirmation
        • Nested PCR
  • méthodes d’empreintes génétiques
    • but = typages génétiques
      • des techniques d’empreintes génétiques ont été adaptées et développées dans le but de faire le typage génétique de la bactérie, augmentant ainsi les chances de comprendre son épidémiologie et par conséquent de permettre une meilleure prise en charge de la maladie.
      • Typage MIRU-VNTR (HotSTartaq PCR)
        • Avantage du MIRU-VNTR = différentiation entre souches non-apparentées, et souches apparentées regroupées.
la pcr comme m thode de d tection de m ulcerans
La PCR comme méthode de détection de M. ulcerans

PCR=Polymerase Chain Reaction (PCR) amplification génique d’ADN

  • Dans le but d’amplifier correctement l’ADN d’un organisme donné, la séquence ADN de cet organisme doit être connue .

En quoi consiste donc le séquençage de l’ADN?

    • C’est une méthode moléculaire de laboratoire qui détermine l’ordre exact des paires de base d’un segment d’ADN, ou
    • Une méthode pour déchiffrer/décoder l’ordre relatif des bases nucléotidiques dans une molécule d’ADN
qu est ce que la pcr
Qu’est-ce que la PCR
  • méthode utilisée pour amplifier des séquences spécifiques d’ADN provenant d’un mélange complexe d’ADN (bactéries, virus, parasites, hommes etc…)
  • une amorce est nécessaire.
  • Qu’est-ce q’une amorce?
    • petite séquence d’acides nucléiques qui sert de point de départ à la réplication de l’ADN.
characteristiqyes de vntr loci du m marinum et m ulcerans per courtesy of ablordey et al jcm 2005
9 F GGTGGATCTCCGCGTCATTTG

R CGACCGCCCTCGAGACAG

10FACAAGCCACGGCGAGATATAG

R GCGGGGCTTTTATCTGCTTA

13F CAGGTATTCCAGGAGATCAAA

R GGCGACAAGGCTCGTT

14F CCTTGTATCCGAGTTTCAGTT

R GTCGACCAGATATGAGCAAT

15F GCCACCGGTCAGGTCAGGTT

R TCACCAACTACGACGGCGTTC

16F CCAACGCTCCCCCAACCAT

RGCTCACAGGCCTTCGCTCAGA

18F CCCGGAATTGCTGATCGTGTA

RGGTGCGCAGACTGGGTCTTA

19FCCGACGGATGAATCTGTAGGT

R TGGCGACGATCGAGTCTC

Characteristiqyes de VNTR loci du M. marinum et M. ulcerans( per courtesy of Ablordey et al. JCM 2005)
le principe de la pcr
PRINCIPE

séparation doubles brins d’ÁDN par la chaleur (dénaturation)

Ensuite, une portion choisie est copiée en ADN

La séquence d’ADN à amplifier est sélectionnée sur base des amorces oligonucléotidiques. Ces amorces sont complémentaires aux extrémités de la région qui doit être amplifiée

Processus répété plusieurs fois augmentant exponentiellement le nombre d’ADN copié.

PRINCIPE

Au terme de chaque cycle de synthèse les complexes ADN sont séparés par la chaleur, et ensuite refroidis afin de permettre à nouveau la fixation des amorces et le copiage.

Différentes amorces sont nécessaires pour les extrémités gauches et droites de la séquence à amplifier. La séquence des bases de l’échantillon d’ADN doit donc être connue.

Le Principe de laPCR
qu est ce qu une nested pcr i
Qu’est-ce qu’une `Nested PCR´ I?
  • La spécificité de la PCR est déterminée par la spécificité des amorces PCR.
    • Les produits d’une réaction initiale d’amplification sont dilués et utilisés comme source d’ADN cible pour une seconde réaction dans laquelle un set d’amorces différentes est utilisé. En effet ces amorces correspondent à des séquences proches et externes à celles utilisées pour la première réaction .
    • Les produits de la réaction d’amplification sont dilués et utilisés comme source d’ADN cible pour une seconde réaction dans laquelle un set d’amorces différentes est utilisé. En effet, ces amorces correspondent à des séquence proches et internes à celles utilisées pour la première réaction. Le produit est plus court que le premier, réduisant ainsi la probabilité d’amplifier un `mauvais´ locus une seconde fois si cela a été le cas la première fois.
que signifie le d part chaud d une pcr hotstartaq pcr qiagen technologies
Que signifie le Départ à chaud d’une PCR ? = Hotstartaq PCR(Qiagen technologies)
  • Les techniques de Hot Start PCR focalisent sur l’inhibition de l’activité de la polymérase durant la préparation de la réaction.
    • En limitant l’activité de la polymérase avant le cycle PCR,(donc en augmentant le temps de dénaturation), l’amplification non-spécifique est réduite et le rendement cible est augmenté.
quelques avantages de la pcr dans le diagnostic de l ulc re de buruli
Quelques avantages de la PCR dans le diagnostic de L’Ulcère de Buruli?
  • La sensibilité
  • La capacité a détecter dés infections latentes
  • Seul un fragment d’ADN suffit pour l’amplification
  • La spécificité et la stabilité (amorces, Nested PCR)
  • Plus rapides que la culture: résultats en qq hrs par apport aux cultures, mais remplace jamais la culture
  • Un grand nombre d’échantillons peuvent être étudiés en même temps
  • La comparaison entre espèces et au sein des espèces (comme c’est le cas de M. marinum and M. ulcerans)
quelques inconv nients de l utilisation de la pcr comme outil diagnostic
Quelques inconvénients de l’utilisation de la PCR comme outil diagnostic
  • Nécessité d’avoir des information sur la séquence d’ADN cible
  • Le manque de fidélité de la réplication, et donc la nécessité d’utiliser la Nested PCR
  • Nécessite a disposer de plusieurs locaux et d’utilise du matériel à usage unique pour éviter du contaminations (faux positifs)
  • Faux négatifs
que faut il pour faire une pcr
Que faut-il pour faire une PCR
  • Echantillon:de l’ADN bactérien
  • Appareil:Un thermocycleur, configuré pour un

protocole spécifique

  • Réactifs: - Un mélange PCR (PCR Mix)
      • Des amorces (forward & reverse primers)
      • Nucléotides; dNTPs (dATP, dCTP, dGTP and dTTP )
      • Une ADN polymérase thermostable (Taq polymerase) Thermus aquqticus
      • Tampon
      • MgCl2+
      • De l’eau distillée

-----------------------------------------------------------------------

      • Solution Q (pour Hotstartaq PCR, produit par Qiagen technologies)

(voir protocoles de travaux pratiques)

empreintes genetiques
EMPREINTES GENETIQUES
  • QU’EST-CE QU’UNE MÉTHODE D’EMPREINTE GÉNÉTIQUE?
    • C’est une méthode moléculaire utilisée pour détecter des différences et/ou des similarités génétiques entre espèces ou au sein d’espèces isolées de sources variées.
    • Les sources peuvent être:
      • Cliniques
        • Ecouvillons provenant d’ulcères
        • Biopsies
        • Autres
      • Environnementales
      • Autres
quelques exemples de m thodes d empreintes g n tiques
Quelques exemples de méthodes d’empreintes génétiques
  • Mycobacterial Interspersed Repetitive Units -Variable Numbers of Tandem Repeats (MIRU-VNTR)
  • Analyse d’endonucléase de restriction (REA)
  • Polymorphisme de longueur des fragments de restriction, après hybridation (RFLP)
  • Spoligotyping
  • Séquençages
slide17
TECHNIQUES actuellement utilisées pour l’identification et l’empreinte génétique de Mycobacterium ulcerans
  • PCR ou Polymerase Chain Reaction.
    • Hotstartaq PCR : pour le typage par la méthode de MIRU-VNTR. Souvent utilisé pour les échantillons cliniques ou les souches du laboratoire (by Qiagen & Agilent technologies)
    • Nested PCR’s : pour les biopsies et les échantillons environnementaux
  • TYPAGE MIRU-VNTR
principe du miru vntr
Principe du MIRU-VNTR
  • MIRU ou “Mycobacterial Interspersed Repetitive Units” sont des tandems de séquences répétées trouvées dans des nombres variables de régions intergéniques ou “Variable Numbers of tandem Repeats“  (VNTR).
  • Dans le but d’étudier les MIRU-VNTR de M. ulcerans, une PCR doit être effectuée pour l’amplification de l’ADN à investiguer.
  • Les produits du PCR (appelés les amplicons) sont mis en évidence manuellement (électrophorèse sur gel), ou par un système automatisé ( Bioanalyzer etc).
  • L'évaluation de la longueur de leurs paires de bases fournit une indication du nombre de répétitions dans chaque locus. 12 loci identifiés comme les plus polymorphes donnent 12 numéros de code qui peuvent être utilisés pour comparer les souches de M. tuberculosis. Mais, chez M. ulcerans seulement 5 loci ont démontré des caractéristiques polymorphiques.
quelques d finitions
Quelques définitions
  • Qu’est-ce q’un locus génétique
    • C’est la position d’un gène sur une carte de liaison génétique ou sur un chromosome.

C’est également la place spécifique, sur le chromosome, où ce gène est situé.

slide20
Position du loci 41 MIRU sur le chromosome H37Rv de M. tuberculosis(avec la gracieuse permission de Supply et al. 2000)
quelques d finitions ii
Quelques définitions II
  • Un marqueur ADNest toute séquence unique d’ADN qui peut être utilisée dans l’hybridation, comme dans la PCR
  • Hybridation
    • Quand l’ADN est chauffé aux températures de dénaturation pour former des ADN simples brins et ensuite refroidi, des doubles hélices vont se reformer (renaturation) au niveau des régions possédant des séquences complémentaires. Cette technique est utile pour la détermination de séquences similaires dans des ADN d’origines différentes mais aussi pour la quantité de séquences répétitives au sein d’un même ADN (typage MIRU-VNTR!).
slide22
Polymorphism in amplicons of locus 40 for 20 isolates of M. tuberculosis Beijing strainGladys Anyo. LSHTM UK,2004
  • Qu’entend-on par Polymorphisme ?
    • Il s’agit de différences, de séquences d’ADN , entre espèces. Des variations génétiques qui apparaissent dans une population sont considérées comme des polymorphismes.
slide23

Mélange réactif pour Hotstartaq PCR [Loci 1, 2, 6, 9, 33]per courtesy of P.Stagier; A. Ablordey. Department of Mycobacteriology. ITM Belgium

slide24
Multilocus Variable-Number Tandem Repeat Typing of Mycobacteriumulcerans; Locus 19( per courtesy of Ablordey et al. JCM 2005)
  • FIG. 2. PCR analysis of VNTR locus 19.
  • (A) M. ulcerans and the intermediate strain. Lanes: L, 100-bp DNA ladder; 1, ITM 5142; 2, ITM 5147; 3, ITM 94-1324; 4, ITM 9537; 5, ITM 94-1331; 6, ITM 94-1328; 7, ITM 98-912; 8, ITM 8756; 9, ITM 842; 10, ITM 7922; 11, ITM 5114; 12, ITM 5143; 13, ITM 00-1026; 14, 50-bp ladder (locus 19); 15, ITM 96-658; 16, ITM 97-111; 17, ITM 97-483; 18, ITM 97-104; 19, ITM 5152; 20, ITM 5155; 21, ITM 97-610; 22, ITM 97-648; 23, ITM 97-680; 24, ITM 94-662; 25, ITM 94-511; 26, negative control.
  • (B) M. marinum. Lanes: L, 100-bp DNA ladder; 27, ITM 8022; 28, ITM 1717; 29, ITM 94-56; 30, ITM 1320; 31, ITM 7732; 32, negative control.
  • 5 genotypes distinguished and 2 South American strains discovered which supports the discrimination between strains even in MU
hotstar taq pcr et miru vntr
Hotstartaq PCR et MIRU-VNTR
  • Voir notes pratiques